Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629258_at:

>probe:Drosophila_2:1629258_at:444:87; Interrogation_Position=2047; Antisense; AGTCGTCGGAGCTGCTGCACCATCA
>probe:Drosophila_2:1629258_at:77:305; Interrogation_Position=2265; Antisense; CCGGCGGGCGTCTGTGATATTCTGC
>probe:Drosophila_2:1629258_at:456:361; Interrogation_Position=2335; Antisense; GCAATGTGCGCCAACGGTGGCACAC
>probe:Drosophila_2:1629258_at:200:197; Interrogation_Position=2347; Antisense; AACGGTGGCACACCTGTCCGGAACT
>probe:Drosophila_2:1629258_at:636:501; Interrogation_Position=2362; Antisense; GTCCGGAACTCCACAAGGCCATGGA
>probe:Drosophila_2:1629258_at:589:531; Interrogation_Position=2389; Antisense; GGGTCACCTACATTGCGGATCAGAC
>probe:Drosophila_2:1629258_at:372:581; Interrogation_Position=2461; Antisense; TGGCCATGGTGCTCGATCGCCTGTT
>probe:Drosophila_2:1629258_at:294:317; Interrogation_Position=2479; Antisense; GCCTGTTCCTGTGGATCTTCACAAT
>probe:Drosophila_2:1629258_at:585:649; Interrogation_Position=2497; Antisense; TCACAATAGCCGTGGTCGTCGGCAC
>probe:Drosophila_2:1629258_at:542:567; Interrogation_Position=2517; Antisense; GGCACCGCTGGCATTATCCTGCAGG
>probe:Drosophila_2:1629258_at:325:305; Interrogation_Position=2561; Antisense; CCGGATGCCCATCGATATAAAGCTA
>probe:Drosophila_2:1629258_at:653:171; Interrogation_Position=2579; Antisense; AAAGCTATCGGAGATCGCCTCGACG
>probe:Drosophila_2:1629258_at:566:281; Interrogation_Position=2597; Antisense; CTCGACGACGGCCAAGCCGAATGTG
>probe:Drosophila_2:1629258_at:683:295; Interrogation_Position=2614; Antisense; CGAATGTGGCCAGGCCTGTGTTGTA

Paste this into a BLAST search page for me
AGTCGTCGGAGCTGCTGCACCATCACCGGCGGGCGTCTGTGATATTCTGCGCAATGTGCGCCAACGGTGGCACACAACGGTGGCACACCTGTCCGGAACTGTCCGGAACTCCACAAGGCCATGGAGGGTCACCTACATTGCGGATCAGACTGGCCATGGTGCTCGATCGCCTGTTGCCTGTTCCTGTGGATCTTCACAATTCACAATAGCCGTGGTCGTCGGCACGGCACCGCTGGCATTATCCTGCAGGCCGGATGCCCATCGATATAAAGCTAAAAGCTATCGGAGATCGCCTCGACGCTCGACGACGGCCAAGCCGAATGTGCGAATGTGGCCAGGCCTGTGTTGTA

Full Affymetrix probeset data:

Annotations for 1629258_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime