FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629259_at:

>probe:Drosophila_2:1629259_at:536:553; Interrogation_Position=118; Antisense; GGAGCTTTCATTTAAATGCCTCAAC
>probe:Drosophila_2:1629259_at:281:185; Interrogation_Position=146; Antisense; AACAACTTTGATCGCGACAAGTGCG
>probe:Drosophila_2:1629259_at:506:397; Interrogation_Position=161; Antisense; GACAAGTGCGAAATATATTTTGCCA
>probe:Drosophila_2:1629259_at:573:185; Interrogation_Position=191; Antisense; AACAATTGCAAGGAGTTCTGGAACA
>probe:Drosophila_2:1629259_at:687:81; Interrogation_Position=240; Antisense; AGGGAATAGCTCCTTATTTGCCGCC
>probe:Drosophila_2:1629259_at:104:701; Interrogation_Position=253; Antisense; TTATTTGCCGCCCTTAGAAGAACGC
>probe:Drosophila_2:1629259_at:620:381; Interrogation_Position=272; Antisense; GAACGCGATGGGATTAAAGCAGAAT
>probe:Drosophila_2:1629259_at:306:389; Interrogation_Position=306; Antisense; GAAAACCCCAACAAAGCTGATAAAT
>probe:Drosophila_2:1629259_at:251:335; Interrogation_Position=321; Antisense; GCTGATAAATGTATCTTCCTATTTA
>probe:Drosophila_2:1629259_at:434:163; Interrogation_Position=362; Antisense; AAATTAGCTATACATCAGGCACCAA
>probe:Drosophila_2:1629259_at:157:271; Interrogation_Position=374; Antisense; CATCAGGCACCAAAGCTTGCACAAG
>probe:Drosophila_2:1629259_at:135:167; Interrogation_Position=66; Antisense; AAATGCCTCGCAATCAAAACGCAGA
>probe:Drosophila_2:1629259_at:276:255; Interrogation_Position=80; Antisense; CAAAACGCAGAGCAGGATAATCCCT
>probe:Drosophila_2:1629259_at:686:73; Interrogation_Position=93; Antisense; AGGATAATCCCTGCCTAAAGGAACA

Paste this into a BLAST search page for me
GGAGCTTTCATTTAAATGCCTCAACAACAACTTTGATCGCGACAAGTGCGGACAAGTGCGAAATATATTTTGCCAAACAATTGCAAGGAGTTCTGGAACAAGGGAATAGCTCCTTATTTGCCGCCTTATTTGCCGCCCTTAGAAGAACGCGAACGCGATGGGATTAAAGCAGAATGAAAACCCCAACAAAGCTGATAAATGCTGATAAATGTATCTTCCTATTTAAAATTAGCTATACATCAGGCACCAACATCAGGCACCAAAGCTTGCACAAGAAATGCCTCGCAATCAAAACGCAGACAAAACGCAGAGCAGGATAATCCCTAGGATAATCCCTGCCTAAAGGAACA

Full Affymetrix probeset data:

Annotations for 1629259_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720