FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629262_at:

>probe:Drosophila_2:1629262_at:438:19; Interrogation_Position=170; Antisense; ATTTGCCGAGCTACTGAAGATTCTG
>probe:Drosophila_2:1629262_at:58:215; Interrogation_Position=207; Antisense; AAGTTTCTGGCCTCCAAGTTCTTCT
>probe:Drosophila_2:1629262_at:526:637; Interrogation_Position=260; Antisense; TCGAGTTCTCCGACAGCTACAGGAA
>probe:Drosophila_2:1629262_at:587:577; Interrogation_Position=299; Antisense; GGCCACGCAGTACATCTTTAGCAAG
>probe:Drosophila_2:1629262_at:358:77; Interrogation_Position=322; Antisense; AGGAGGACTCCGATCAACTGCAGGT
>probe:Drosophila_2:1629262_at:252:367; Interrogation_Position=366; Antisense; GAATCTGAGTTCGAACTTCTCGCAA
>probe:Drosophila_2:1629262_at:424:229; Interrogation_Position=390; Antisense; AATGTTTTCTTTTCAGCGGCTTACG
>probe:Drosophila_2:1629262_at:685:331; Interrogation_Position=405; Antisense; GCGGCTTACGATGCTGAATCTGCGT
>probe:Drosophila_2:1629262_at:198:367; Interrogation_Position=420; Antisense; GAATCTGCGTTGAAGCTAACCTTGA
>probe:Drosophila_2:1629262_at:674:351; Interrogation_Position=502; Antisense; GCAGCTTGGCATATGTGGAGTTCTT
>probe:Drosophila_2:1629262_at:127:551; Interrogation_Position=518; Antisense; GGAGTTCTTGTGCAAAACCCTGCCA
>probe:Drosophila_2:1629262_at:140:177; Interrogation_Position=532; Antisense; AAACCCTGCCAGATGAAGCGCTAAA
>probe:Drosophila_2:1629262_at:50:659; Interrogation_Position=577; Antisense; TAAGTACCCTGTTGGATCTTCACCG
>probe:Drosophila_2:1629262_at:287:677; Interrogation_Position=613; Antisense; TAGACGAGGCATTCGCCAGCTTTAG

Paste this into a BLAST search page for me
ATTTGCCGAGCTACTGAAGATTCTGAAGTTTCTGGCCTCCAAGTTCTTCTTCGAGTTCTCCGACAGCTACAGGAAGGCCACGCAGTACATCTTTAGCAAGAGGAGGACTCCGATCAACTGCAGGTGAATCTGAGTTCGAACTTCTCGCAAAATGTTTTCTTTTCAGCGGCTTACGGCGGCTTACGATGCTGAATCTGCGTGAATCTGCGTTGAAGCTAACCTTGAGCAGCTTGGCATATGTGGAGTTCTTGGAGTTCTTGTGCAAAACCCTGCCAAAACCCTGCCAGATGAAGCGCTAAATAAGTACCCTGTTGGATCTTCACCGTAGACGAGGCATTCGCCAGCTTTAG

Full Affymetrix probeset data:

Annotations for 1629262_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720