FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629263_at:

>probe:Drosophila_2:1629263_at:264:475; Interrogation_Position=3174; Antisense; GTTAGCGATGAGCATAGACCCCACA
>probe:Drosophila_2:1629263_at:472:147; Interrogation_Position=3202; Antisense; ACTACCGCTTGGAGGGTGGCTTCAA
>probe:Drosophila_2:1629263_at:527:521; Interrogation_Position=3217; Antisense; GTGGCTTCAATTCCCTGAACTACGG
>probe:Drosophila_2:1629263_at:627:335; Interrogation_Position=3264; Antisense; GTTCGTTTTGAAAATCCCGCAAATG
>probe:Drosophila_2:1629263_at:4:613; Interrogation_Position=3287; Antisense; TGAAAGACCCCATTACAACTATCCC
>probe:Drosophila_2:1629263_at:704:683; Interrogation_Position=3306; Antisense; TATCCCAATGCAAACTACATCAGTG
>probe:Drosophila_2:1629263_at:111:183; Interrogation_Position=3358; Antisense; AAAAGCCTCACTACGAAGATGACAA
>probe:Drosophila_2:1629263_at:461:699; Interrogation_Position=3388; Antisense; TTTATGTTACCAACTCGCAGGGAGT
>probe:Drosophila_2:1629263_at:191:295; Interrogation_Position=3403; Antisense; CGCAGGGAGTTAACGAGTACTATAT
>probe:Drosophila_2:1629263_at:702:89; Interrogation_Position=3418; Antisense; AGTACTATATACGACCTGATGGCAG
>probe:Drosophila_2:1629263_at:232:13; Interrogation_Position=3561; Antisense; ATTCTTTGTAGCTTAACTAGATCAG
>probe:Drosophila_2:1629263_at:603:651; Interrogation_Position=3608; Antisense; TTAAGTTTCCTATCTTTGCGTTAAT
>probe:Drosophila_2:1629263_at:292:615; Interrogation_Position=3660; Antisense; TGAAGACCCACACAGAGGCAGGCCA
>probe:Drosophila_2:1629263_at:548:347; Interrogation_Position=3677; Antisense; GCAGGCCACCACTTAGTCACATAAG

Paste this into a BLAST search page for me
GTTAGCGATGAGCATAGACCCCACAACTACCGCTTGGAGGGTGGCTTCAAGTGGCTTCAATTCCCTGAACTACGGGTTCGTTTTGAAAATCCCGCAAATGTGAAAGACCCCATTACAACTATCCCTATCCCAATGCAAACTACATCAGTGAAAAGCCTCACTACGAAGATGACAATTTATGTTACCAACTCGCAGGGAGTCGCAGGGAGTTAACGAGTACTATATAGTACTATATACGACCTGATGGCAGATTCTTTGTAGCTTAACTAGATCAGTTAAGTTTCCTATCTTTGCGTTAATTGAAGACCCACACAGAGGCAGGCCAGCAGGCCACCACTTAGTCACATAAG

Full Affymetrix probeset data:

Annotations for 1629263_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720