FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629265_at:

>probe:Drosophila_2:1629265_at:62:595; Interrogation_Position=1139; Antisense; TGGGCGTGGGCAGGATTCTTAATCA
>probe:Drosophila_2:1629265_at:55:77; Interrogation_Position=1163; Antisense; AGGATGCGATCTTCAGTGGCTACTT
>probe:Drosophila_2:1629265_at:624:553; Interrogation_Position=1199; Antisense; GGACCACCGTGGTTACCCAGAACAT
>probe:Drosophila_2:1629265_at:674:189; Interrogation_Position=1219; Antisense; AACATGGTAGCCTGTCGGCTGGAGC
>probe:Drosophila_2:1629265_at:467:621; Interrogation_Position=1262; Antisense; TGCGCTTCCAACCAGATCGATGGCT
>probe:Drosophila_2:1629265_at:146:449; Interrogation_Position=1276; Antisense; GATCGATGGCTCCAGCACCGTAGTG
>probe:Drosophila_2:1629265_at:308:717; Interrogation_Position=1327; Antisense; TTCGGTCACGGAATGCGGGCCTGCA
>probe:Drosophila_2:1629265_at:63:301; Interrogation_Position=1357; Antisense; CGCCGTTTGGCCGAGCAGAATATGC
>probe:Drosophila_2:1629265_at:182:683; Interrogation_Position=1377; Antisense; TATGCACATTTTGCTTCTCAGGCTG
>probe:Drosophila_2:1629265_at:695:709; Interrogation_Position=1391; Antisense; TTCTCAGGCTGCTGCGTGAATACGA
>probe:Drosophila_2:1629265_at:146:663; Interrogation_Position=1466; Antisense; TAAATAAACCCGATGCTCCAGTGCT
>probe:Drosophila_2:1629265_at:195:337; Interrogation_Position=1480; Antisense; GCTCCAGTGCTGATCGATCTGCGAT
>probe:Drosophila_2:1629265_at:221:423; Interrogation_Position=1558; Antisense; GAGAAACTAGACTCGTGTCACGTTT
>probe:Drosophila_2:1629265_at:38:335; Interrogation_Position=1680; Antisense; GCTGTGGGTGTTTTGGTCTAAGTAC

Paste this into a BLAST search page for me
TGGGCGTGGGCAGGATTCTTAATCAAGGATGCGATCTTCAGTGGCTACTTGGACCACCGTGGTTACCCAGAACATAACATGGTAGCCTGTCGGCTGGAGCTGCGCTTCCAACCAGATCGATGGCTGATCGATGGCTCCAGCACCGTAGTGTTCGGTCACGGAATGCGGGCCTGCACGCCGTTTGGCCGAGCAGAATATGCTATGCACATTTTGCTTCTCAGGCTGTTCTCAGGCTGCTGCGTGAATACGATAAATAAACCCGATGCTCCAGTGCTGCTCCAGTGCTGATCGATCTGCGATGAGAAACTAGACTCGTGTCACGTTTGCTGTGGGTGTTTTGGTCTAAGTAC

Full Affymetrix probeset data:

Annotations for 1629265_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720