FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629269_at:

>probe:Drosophila_2:1629269_at:326:667; Interrogation_Position=2389; Antisense; TACTTCATAGCAAAATGGTCCGTAT
>probe:Drosophila_2:1629269_at:657:167; Interrogation_Position=2458; Antisense; AAAGGCGTAGTGCATATCCAGAATT
>probe:Drosophila_2:1629269_at:160:241; Interrogation_Position=2488; Antisense; AATAAACACAATAGCTCTCCAAGAG
>probe:Drosophila_2:1629269_at:454:337; Interrogation_Position=2501; Antisense; GCTCTCCAAGAGATACCATTTTTAT
>probe:Drosophila_2:1629269_at:351:211; Interrogation_Position=2557; Antisense; AAGACATTTTATTGCGCAGCCCAAA
>probe:Drosophila_2:1629269_at:593:655; Interrogation_Position=2606; Antisense; TAATAATAATCGCATGTCTACCCAA
>probe:Drosophila_2:1629269_at:458:43; Interrogation_Position=2614; Antisense; ATCGCATGTCTACCCAAAACCAATA
>probe:Drosophila_2:1629269_at:24:13; Interrogation_Position=2732; Antisense; ATTACTTTGTAAATACTTCCAGCTA
>probe:Drosophila_2:1629269_at:388:241; Interrogation_Position=2743; Antisense; AATACTTCCAGCTATCTCAAGTTGA
>probe:Drosophila_2:1629269_at:639:37; Interrogation_Position=2756; Antisense; ATCTCAAGTTGATGTCAGTGACGTA
>probe:Drosophila_2:1629269_at:152:655; Interrogation_Position=2836; Antisense; TAATCTTAAGTACAGCTGCGCCAAA
>probe:Drosophila_2:1629269_at:513:171; Interrogation_Position=2865; Antisense; AAAGAACACTAGACAGCCAGTTTAA
>probe:Drosophila_2:1629269_at:35:513; Interrogation_Position=2905; Antisense; GTGAGTTGATGTATACCTTACGATA
>probe:Drosophila_2:1629269_at:66:453; Interrogation_Position=2926; Antisense; GATAAAACCATAATAAACCCTTGAT

Paste this into a BLAST search page for me
TACTTCATAGCAAAATGGTCCGTATAAAGGCGTAGTGCATATCCAGAATTAATAAACACAATAGCTCTCCAAGAGGCTCTCCAAGAGATACCATTTTTATAAGACATTTTATTGCGCAGCCCAAATAATAATAATCGCATGTCTACCCAAATCGCATGTCTACCCAAAACCAATAATTACTTTGTAAATACTTCCAGCTAAATACTTCCAGCTATCTCAAGTTGAATCTCAAGTTGATGTCAGTGACGTATAATCTTAAGTACAGCTGCGCCAAAAAAGAACACTAGACAGCCAGTTTAAGTGAGTTGATGTATACCTTACGATAGATAAAACCATAATAAACCCTTGAT

Full Affymetrix probeset data:

Annotations for 1629269_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720