FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629270_at:

>probe:Drosophila_2:1629270_at:203:313; Interrogation_Position=1044; Antisense; GCCACGAGGCTGAGGAGAACCCCAT
>probe:Drosophila_2:1629270_at:63:109; Interrogation_Position=1059; Antisense; AGAACCCCATCATATGCAGCATCTG
>probe:Drosophila_2:1629270_at:283:347; Interrogation_Position=1077; Antisense; GCATCTGCAATGTGTCGTTCAAGTC
>probe:Drosophila_2:1629270_at:49:473; Interrogation_Position=1093; Antisense; GTTCAAGTCGCGCAAGACCTTCAAC
>probe:Drosophila_2:1629270_at:207:75; Interrogation_Position=1137; Antisense; AGGAGAACCGCCCAAGACACTACTG
>probe:Drosophila_2:1629270_at:274:375; Interrogation_Position=1213; Antisense; GAAGACCCACGAGGGCGACGTCGTT
>probe:Drosophila_2:1629270_at:275:419; Interrogation_Position=1286; Antisense; GAGCTGCATGTGGACGTCGACGAAT
>probe:Drosophila_2:1629270_at:244:609; Interrogation_Position=1348; Antisense; TGAGAACAGCGGCTTCTGTCTCATT
>probe:Drosophila_2:1629270_at:540:343; Interrogation_Position=1359; Antisense; GCTTCTGTCTCATTTGCAATACCAA
>probe:Drosophila_2:1629270_at:77:371; Interrogation_Position=1396; Antisense; GAAGGAGCTCGAACACCACTTGCAA
>probe:Drosophila_2:1629270_at:431:273; Interrogation_Position=1414; Antisense; CTTGCAATTTGATCACGACGTGGTC
>probe:Drosophila_2:1629270_at:695:701; Interrogation_Position=1475; Antisense; TTATCTTTCCCTAGTGTATTTCCTC
>probe:Drosophila_2:1629270_at:262:19; Interrogation_Position=1492; Antisense; ATTTCCTCCTCTTTGTACTTGATTA
>probe:Drosophila_2:1629270_at:653:107; Interrogation_Position=990; Antisense; AGAAGTGCGGCCTGAGGTTCTCCCA

Paste this into a BLAST search page for me
GCCACGAGGCTGAGGAGAACCCCATAGAACCCCATCATATGCAGCATCTGGCATCTGCAATGTGTCGTTCAAGTCGTTCAAGTCGCGCAAGACCTTCAACAGGAGAACCGCCCAAGACACTACTGGAAGACCCACGAGGGCGACGTCGTTGAGCTGCATGTGGACGTCGACGAATTGAGAACAGCGGCTTCTGTCTCATTGCTTCTGTCTCATTTGCAATACCAAGAAGGAGCTCGAACACCACTTGCAACTTGCAATTTGATCACGACGTGGTCTTATCTTTCCCTAGTGTATTTCCTCATTTCCTCCTCTTTGTACTTGATTAAGAAGTGCGGCCTGAGGTTCTCCCA

Full Affymetrix probeset data:

Annotations for 1629270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720