FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629271_at:

>probe:Drosophila_2:1629271_at:211:99; Interrogation_Position=2235; Antisense; AGAGTCTTCCATATACACGTAAACA
>probe:Drosophila_2:1629271_at:665:513; Interrogation_Position=2283; Antisense; GTGTTGCAAATGTTCACAAGCGCAT
>probe:Drosophila_2:1629271_at:373:253; Interrogation_Position=2299; Antisense; CAAGCGCATCATTAAGAGGCCTCTT
>probe:Drosophila_2:1629271_at:411:485; Interrogation_Position=2362; Antisense; GTAGGAGTCTACCTCAATGAACTTT
>probe:Drosophila_2:1629271_at:694:277; Interrogation_Position=2415; Antisense; CTAAAAGCGAGTTGGCCGACTACTT
>probe:Drosophila_2:1629271_at:184:297; Interrogation_Position=2431; Antisense; CGACTACTTTCCCATGTTGAGCATT
>probe:Drosophila_2:1629271_at:317:307; Interrogation_Position=2442; Antisense; CCATGTTGAGCATTGGCAGCCACAA
>probe:Drosophila_2:1629271_at:84:13; Interrogation_Position=2522; Antisense; ATTCATACCTCTTAGTTACTCGATA
>probe:Drosophila_2:1629271_at:673:29; Interrogation_Position=2582; Antisense; ATACACTACAGTGAGCACCGCCTAT
>probe:Drosophila_2:1629271_at:392:21; Interrogation_Position=2609; Antisense; ATAGTTACTACATGGCTCTTAAAGC
>probe:Drosophila_2:1629271_at:85:209; Interrogation_Position=2630; Antisense; AAGCATTACATTGCGCCACAGTGTG
>probe:Drosophila_2:1629271_at:451:715; Interrogation_Position=2657; Antisense; TTCTGTTTACTTATATACCTCTACT
>probe:Drosophila_2:1629271_at:453:243; Interrogation_Position=2708; Antisense; AATTATATACTCGTGTCGTGTCGCA
>probe:Drosophila_2:1629271_at:490:515; Interrogation_Position=2720; Antisense; GTGTCGTGTCGCAATCAACCATTGA

Paste this into a BLAST search page for me
AGAGTCTTCCATATACACGTAAACAGTGTTGCAAATGTTCACAAGCGCATCAAGCGCATCATTAAGAGGCCTCTTGTAGGAGTCTACCTCAATGAACTTTCTAAAAGCGAGTTGGCCGACTACTTCGACTACTTTCCCATGTTGAGCATTCCATGTTGAGCATTGGCAGCCACAAATTCATACCTCTTAGTTACTCGATAATACACTACAGTGAGCACCGCCTATATAGTTACTACATGGCTCTTAAAGCAAGCATTACATTGCGCCACAGTGTGTTCTGTTTACTTATATACCTCTACTAATTATATACTCGTGTCGTGTCGCAGTGTCGTGTCGCAATCAACCATTGA

Full Affymetrix probeset data:

Annotations for 1629271_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720