FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629272_at:

>probe:Drosophila_2:1629272_at:45:411; Interrogation_Position=1416; Antisense; GACGCGGGCAACAGTCAAGCTTCAG
>probe:Drosophila_2:1629272_at:412:375; Interrogation_Position=1448; Antisense; GAAGACGGCCTTTTACATTGTCACC
>probe:Drosophila_2:1629272_at:662:3; Interrogation_Position=1464; Antisense; ATTGTCACCGACACGTTGAGGGATT
>probe:Drosophila_2:1629272_at:81:427; Interrogation_Position=1504; Antisense; GAGAGGGTTTCAGCCTGCTGGACAT
>probe:Drosophila_2:1629272_at:294:401; Interrogation_Position=1524; Antisense; GACATGTTCGGCAGTGCACCGGAGA
>probe:Drosophila_2:1629272_at:333:375; Interrogation_Position=1595; Antisense; GAAGATCCTGGTGGGCAAGACGTCT
>probe:Drosophila_2:1629272_at:50:409; Interrogation_Position=1613; Antisense; GACGTCTGCCAATAAGCTCGGACTG
>probe:Drosophila_2:1629272_at:70:257; Interrogation_Position=1793; Antisense; CAAATTGGAGTCCTTCTTCATACCC
>probe:Drosophila_2:1629272_at:314:177; Interrogation_Position=1820; Antisense; AAACGATCCTCGTCTCAAGGAGGGC
>probe:Drosophila_2:1629272_at:571:433; Interrogation_Position=1839; Antisense; GAGGGCGCCAAGTTTTTCAAGTCCA
>probe:Drosophila_2:1629272_at:23:225; Interrogation_Position=1866; Antisense; AAGGCGGTGGTTGACCATGCCGAAT
>probe:Drosophila_2:1629272_at:633:681; Interrogation_Position=1890; Antisense; TATGACCAAGTGAAGAACCGCCTGA
>probe:Drosophila_2:1629272_at:540:201; Interrogation_Position=1905; Antisense; AACCGCCTGAAATTGCTGATCACCA
>probe:Drosophila_2:1629272_at:197:377; Interrogation_Position=1946; Antisense; GAAGAAGAGCCTGCCCAGCAAGGAT

Paste this into a BLAST search page for me
GACGCGGGCAACAGTCAAGCTTCAGGAAGACGGCCTTTTACATTGTCACCATTGTCACCGACACGTTGAGGGATTGAGAGGGTTTCAGCCTGCTGGACATGACATGTTCGGCAGTGCACCGGAGAGAAGATCCTGGTGGGCAAGACGTCTGACGTCTGCCAATAAGCTCGGACTGCAAATTGGAGTCCTTCTTCATACCCAAACGATCCTCGTCTCAAGGAGGGCGAGGGCGCCAAGTTTTTCAAGTCCAAAGGCGGTGGTTGACCATGCCGAATTATGACCAAGTGAAGAACCGCCTGAAACCGCCTGAAATTGCTGATCACCAGAAGAAGAGCCTGCCCAGCAAGGAT

Full Affymetrix probeset data:

Annotations for 1629272_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720