FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629277_at:

>probe:Drosophila_2:1629277_at:406:547; Interrogation_Position=2106; Antisense; GGATGGAGACGATCAGCTAACCCTG
>probe:Drosophila_2:1629277_at:311:329; Interrogation_Position=2121; Antisense; GCTAACCCTGGAGGAATTTTCCGAT
>probe:Drosophila_2:1629277_at:140:43; Interrogation_Position=2190; Antisense; ATCGAAGACTTTGGTGGAGCGACGC
>probe:Drosophila_2:1629277_at:310:551; Interrogation_Position=2217; Antisense; GGAGTTCAAGCGGATCATCGATAAG
>probe:Drosophila_2:1629277_at:406:419; Interrogation_Position=2269; Antisense; GAGCTACTGAACTATGTGAACCCCA
>probe:Drosophila_2:1629277_at:322:509; Interrogation_Position=2284; Antisense; GTGAACCCCAAGACTCCGCGGTATG
>probe:Drosophila_2:1629277_at:605:147; Interrogation_Position=2326; Antisense; ACTTTGTTCAGCCTGTGCGACGAGA
>probe:Drosophila_2:1629277_at:613:119; Interrogation_Position=2360; Antisense; AGCTGCTGACCCTCAAAGAGATGAC
>probe:Drosophila_2:1629277_at:603:213; Interrogation_Position=2375; Antisense; AAGAGATGACTGATCATGCCGAGAT
>probe:Drosophila_2:1629277_at:443:625; Interrogation_Position=2391; Antisense; TGCCGAGATATTTCTGCAATCCAAG
>probe:Drosophila_2:1629277_at:89:457; Interrogation_Position=2422; Antisense; GATACGGCGAATAGTTTTCACACAG
>probe:Drosophila_2:1629277_at:393:429; Interrogation_Position=2446; Antisense; GAGTTCTAGCTTAATTCTTTACCAT
>probe:Drosophila_2:1629277_at:354:515; Interrogation_Position=2461; Antisense; TCTTTACCATCACTAAACCTTTCAC
>probe:Drosophila_2:1629277_at:159:1; Interrogation_Position=2620; Antisense; ATCATTTCCCGTGTGATTTTTCAAT

Paste this into a BLAST search page for me
GGATGGAGACGATCAGCTAACCCTGGCTAACCCTGGAGGAATTTTCCGATATCGAAGACTTTGGTGGAGCGACGCGGAGTTCAAGCGGATCATCGATAAGGAGCTACTGAACTATGTGAACCCCAGTGAACCCCAAGACTCCGCGGTATGACTTTGTTCAGCCTGTGCGACGAGAAGCTGCTGACCCTCAAAGAGATGACAAGAGATGACTGATCATGCCGAGATTGCCGAGATATTTCTGCAATCCAAGGATACGGCGAATAGTTTTCACACAGGAGTTCTAGCTTAATTCTTTACCATTCTTTACCATCACTAAACCTTTCACATCATTTCCCGTGTGATTTTTCAAT

Full Affymetrix probeset data:

Annotations for 1629277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720