FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629279_at:

>probe:Drosophila_2:1629279_at:711:459; Interrogation_Position=3113; Antisense; GATTTTGTTCACGAATTCCTCAACG
>probe:Drosophila_2:1629279_at:334:509; Interrogation_Position=3188; Antisense; GTGCTCAACTATTCGATACCCAAGA
>probe:Drosophila_2:1629279_at:54:525; Interrogation_Position=3217; Antisense; GGGCGTCTCGAAATTCTGCCTGAAT
>probe:Drosophila_2:1629279_at:171:235; Interrogation_Position=3244; Antisense; AATCCAGACGACGTTGTCCATGCTG
>probe:Drosophila_2:1629279_at:106:53; Interrogation_Position=3263; Antisense; ATGCTGACCGCATCGACCAAGTGTA
>probe:Drosophila_2:1629279_at:631:413; Interrogation_Position=3277; Antisense; GACCAAGTGTAGATTCCTGCGCAAT
>probe:Drosophila_2:1629279_at:395:517; Interrogation_Position=3326; Antisense; GTGGAAACGTTTCCCATTCTGGCCG
>probe:Drosophila_2:1629279_at:78:411; Interrogation_Position=3350; Antisense; GACGACTGCGTCAACATCCTGATGA
>probe:Drosophila_2:1629279_at:18:619; Interrogation_Position=3390; Antisense; TGCATTCGCAGTCATCGCTGGGCAT
>probe:Drosophila_2:1629279_at:545:585; Interrogation_Position=3423; Antisense; TGGAAATGCCACTCACCGATAGCGA
>probe:Drosophila_2:1629279_at:468:395; Interrogation_Position=3446; Antisense; GACAAGCTCTGCACGTATCGGGATG
>probe:Drosophila_2:1629279_at:265:711; Interrogation_Position=3504; Antisense; TTAAGGCACTGGTCACGGCGGTCAT
>probe:Drosophila_2:1629279_at:650:41; Interrogation_Position=3535; Antisense; ATCGGACCTGTATTAGTTGGACTCG
>probe:Drosophila_2:1629279_at:516:631; Interrogation_Position=3561; Antisense; TCCCGCCTTGTTTTTCATAGTCGTA

Paste this into a BLAST search page for me
GATTTTGTTCACGAATTCCTCAACGGTGCTCAACTATTCGATACCCAAGAGGGCGTCTCGAAATTCTGCCTGAATAATCCAGACGACGTTGTCCATGCTGATGCTGACCGCATCGACCAAGTGTAGACCAAGTGTAGATTCCTGCGCAATGTGGAAACGTTTCCCATTCTGGCCGGACGACTGCGTCAACATCCTGATGATGCATTCGCAGTCATCGCTGGGCATTGGAAATGCCACTCACCGATAGCGAGACAAGCTCTGCACGTATCGGGATGTTAAGGCACTGGTCACGGCGGTCATATCGGACCTGTATTAGTTGGACTCGTCCCGCCTTGTTTTTCATAGTCGTA

Full Affymetrix probeset data:

Annotations for 1629279_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720