FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629280_at:

>probe:Drosophila_2:1629280_at:362:383; Interrogation_Position=2295; Antisense; GAACTTTTGTATTAGGCTTAAGCAA
>probe:Drosophila_2:1629280_at:183:679; Interrogation_Position=2331; Antisense; TATGGAATTGGTGCTTTACGAAGAT
>probe:Drosophila_2:1629280_at:7:241; Interrogation_Position=2362; Antisense; AATACAATGGCCTCAAAGGATATTT
>probe:Drosophila_2:1629280_at:164:391; Interrogation_Position=2401; Antisense; GAAACGAACAGTGAATGCTTTTAGA
>probe:Drosophila_2:1629280_at:131:365; Interrogation_Position=2442; Antisense; GAATTATTTATCCATTATAGCGCAT
>probe:Drosophila_2:1629280_at:2:55; Interrogation_Position=2471; Antisense; ATGCAAACATTAGAGCTGTGGCTTT
>probe:Drosophila_2:1629280_at:135:419; Interrogation_Position=2483; Antisense; GAGCTGTGGCTTTTACATCTAATAC
>probe:Drosophila_2:1629280_at:143:43; Interrogation_Position=2512; Antisense; ATCGACCTGTAGTTCAAACAGCGCA
>probe:Drosophila_2:1629280_at:719:179; Interrogation_Position=2527; Antisense; AAACAGCGCACATCAGGCAGAATTT
>probe:Drosophila_2:1629280_at:418:23; Interrogation_Position=2721; Antisense; ATATCTGTATTCTTTCCATTTTTAA
>probe:Drosophila_2:1629280_at:725:657; Interrogation_Position=2743; Antisense; TAAGTTATGTTGTTCACTCAGCTAA
>probe:Drosophila_2:1629280_at:661:473; Interrogation_Position=2754; Antisense; GTTCACTCAGCTAATCGTAGTTCAG
>probe:Drosophila_2:1629280_at:35:473; Interrogation_Position=2773; Antisense; GTTCAGTGAACCCTCTAACAATGTT
>probe:Drosophila_2:1629280_at:395:397; Interrogation_Position=2830; Antisense; GACAAGGCGCGTACATCTATCAAAT

Paste this into a BLAST search page for me
GAACTTTTGTATTAGGCTTAAGCAATATGGAATTGGTGCTTTACGAAGATAATACAATGGCCTCAAAGGATATTTGAAACGAACAGTGAATGCTTTTAGAGAATTATTTATCCATTATAGCGCATATGCAAACATTAGAGCTGTGGCTTTGAGCTGTGGCTTTTACATCTAATACATCGACCTGTAGTTCAAACAGCGCAAAACAGCGCACATCAGGCAGAATTTATATCTGTATTCTTTCCATTTTTAATAAGTTATGTTGTTCACTCAGCTAAGTTCACTCAGCTAATCGTAGTTCAGGTTCAGTGAACCCTCTAACAATGTTGACAAGGCGCGTACATCTATCAAAT

Full Affymetrix probeset data:

Annotations for 1629280_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720