FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629281_at:

>probe:Drosophila_2:1629281_at:414:633; Interrogation_Position=2846; Antisense; TCGTCTGGAATAGACACTTCCGTTT
>probe:Drosophila_2:1629281_at:519:35; Interrogation_Position=2881; Antisense; ATCTACGGGCGCATCTGGAAATAAT
>probe:Drosophila_2:1629281_at:632:251; Interrogation_Position=2907; Antisense; CAAGTGCATTCTTTATTTCGGATGA
>probe:Drosophila_2:1629281_at:406:325; Interrogation_Position=2984; Antisense; GCGACAGGATCAAGCTCACAGCGAT
>probe:Drosophila_2:1629281_at:212:121; Interrogation_Position=3003; Antisense; AGCGATCTTCAGTAGCGAGCAGCAC
>probe:Drosophila_2:1629281_at:304:421; Interrogation_Position=3019; Antisense; GAGCAGCACCTATGAATCTTCGGAT
>probe:Drosophila_2:1629281_at:384:461; Interrogation_Position=3047; Antisense; GATTCTGTAACTGTAACCAATGTCA
>probe:Drosophila_2:1629281_at:1:55; Interrogation_Position=3077; Antisense; ATGCAGAACGCTCAATCATTGTGGT
>probe:Drosophila_2:1629281_at:645:349; Interrogation_Position=3103; Antisense; GCAGACTTTCAACATGCAGTACCAA
>probe:Drosophila_2:1629281_at:573:487; Interrogation_Position=3121; Antisense; GTACCAATTCATTGCATCCCATGTG
>probe:Drosophila_2:1629281_at:677:45; Interrogation_Position=3136; Antisense; ATCCCATGTGGCCAAGAATCTACAG
>probe:Drosophila_2:1629281_at:82:191; Interrogation_Position=3218; Antisense; AACTCAACTAATCACTTCATTCGGA
>probe:Drosophila_2:1629281_at:613:437; Interrogation_Position=3266; Antisense; GAGGCTGTATCAGTCTCTTTCCTTA
>probe:Drosophila_2:1629281_at:234:481; Interrogation_Position=3296; Antisense; GTATATCGTAGCCAGTTAAACCGTT

Paste this into a BLAST search page for me
TCGTCTGGAATAGACACTTCCGTTTATCTACGGGCGCATCTGGAAATAATCAAGTGCATTCTTTATTTCGGATGAGCGACAGGATCAAGCTCACAGCGATAGCGATCTTCAGTAGCGAGCAGCACGAGCAGCACCTATGAATCTTCGGATGATTCTGTAACTGTAACCAATGTCAATGCAGAACGCTCAATCATTGTGGTGCAGACTTTCAACATGCAGTACCAAGTACCAATTCATTGCATCCCATGTGATCCCATGTGGCCAAGAATCTACAGAACTCAACTAATCACTTCATTCGGAGAGGCTGTATCAGTCTCTTTCCTTAGTATATCGTAGCCAGTTAAACCGTT

Full Affymetrix probeset data:

Annotations for 1629281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720