FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629283_at:

>probe:Drosophila_2:1629283_at:321:189; Interrogation_Position=1339; Antisense; AACAGTCCGGCGAATCTTAAGCACG
>probe:Drosophila_2:1629283_at:601:377; Interrogation_Position=1377; Antisense; GAAGCTGCTGGCCAGTAGCACAAGT
>probe:Drosophila_2:1629283_at:66:665; Interrogation_Position=1424; Antisense; TAAATGGACCTACGACACAGCCGCA
>probe:Drosophila_2:1629283_at:89:155; Interrogation_Position=1440; Antisense; ACAGCCGCAGGTAGTGTCCATTCCA
>probe:Drosophila_2:1629283_at:273:9; Interrogation_Position=1459; Antisense; ATTCCAGCGGATCGTTATATCAGGC
>probe:Drosophila_2:1629283_at:392:645; Interrogation_Position=1478; Antisense; TCAGGCTGGCTGAGTCACGATCGGT
>probe:Drosophila_2:1629283_at:603:249; Interrogation_Position=1521; Antisense; CAATCTGCTTTTTGCGTTGCCGGCT
>probe:Drosophila_2:1629283_at:611:41; Interrogation_Position=1590; Antisense; ATCGTCACCGAATTCCGAGTCTGAA
>probe:Drosophila_2:1629283_at:258:251; Interrogation_Position=1638; Antisense; CAAGTCCCTTTCCAACAGTATTTCG
>probe:Drosophila_2:1629283_at:290:523; Interrogation_Position=1673; Antisense; GGGCCAAGGCAGTCATTAACTCCAA
>probe:Drosophila_2:1629283_at:186:371; Interrogation_Position=1749; Antisense; GAAGTTGCCTTCATCCAAAACGGGA
>probe:Drosophila_2:1629283_at:132:499; Interrogation_Position=1770; Antisense; GGGAACGATTTACAGAACCGCCGAT
>probe:Drosophila_2:1629283_at:675:671; Interrogation_Position=1807; Antisense; TACGAAGCCGAGAGTCCTGATGAGT
>probe:Drosophila_2:1629283_at:7:55; Interrogation_Position=1826; Antisense; ATGAGTTGGCCCTCGTGAATGCAGC

Paste this into a BLAST search page for me
AACAGTCCGGCGAATCTTAAGCACGGAAGCTGCTGGCCAGTAGCACAAGTTAAATGGACCTACGACACAGCCGCAACAGCCGCAGGTAGTGTCCATTCCAATTCCAGCGGATCGTTATATCAGGCTCAGGCTGGCTGAGTCACGATCGGTCAATCTGCTTTTTGCGTTGCCGGCTATCGTCACCGAATTCCGAGTCTGAACAAGTCCCTTTCCAACAGTATTTCGGGGCCAAGGCAGTCATTAACTCCAAGAAGTTGCCTTCATCCAAAACGGGAGGGAACGATTTACAGAACCGCCGATTACGAAGCCGAGAGTCCTGATGAGTATGAGTTGGCCCTCGTGAATGCAGC

Full Affymetrix probeset data:

Annotations for 1629283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720