FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629287_at:

>probe:Drosophila_2:1629287_at:551:93; Interrogation_Position=101; Antisense; AGTTCGATCACTGGGACGATGCCAT
>probe:Drosophila_2:1629287_at:612:49; Interrogation_Position=119; Antisense; ATGCCATACACGGTTTTCGGGAGAC
>probe:Drosophila_2:1629287_at:382:101; Interrogation_Position=174; Antisense; AGAGATCCTGGAGCGCGTGCGCCAA
>probe:Drosophila_2:1629287_at:704:439; Interrogation_Position=208; Antisense; GATGGAGCAGTTATGCCCTATGTCC
>probe:Drosophila_2:1629287_at:562:681; Interrogation_Position=226; Antisense; TATGTCCACATCCTAGATCTTGCAC
>probe:Drosophila_2:1629287_at:342:37; Interrogation_Position=242; Antisense; ATCTTGCACCCGATGGCGTTATCAA
>probe:Drosophila_2:1629287_at:551:331; Interrogation_Position=293; Antisense; GCGGCAACACCATCTCTGGAATCAG
>probe:Drosophila_2:1629287_at:641:365; Interrogation_Position=311; Antisense; GAATCAGCCTACTTAGCGACAGTGT
>probe:Drosophila_2:1629287_at:708:353; Interrogation_Position=350; Antisense; GCACGGATGAGCAGCGGTACCAACA
>probe:Drosophila_2:1629287_at:675:235; Interrogation_Position=377; Antisense; AATCGTCGGGAACTGCAACGGATCC
>probe:Drosophila_2:1629287_at:57:211; Interrogation_Position=460; Antisense; AAGAACAACTTCTACGCTGACATCC
>probe:Drosophila_2:1629287_at:356:225; Interrogation_Position=556; Antisense; AAGGAGCACTCCCAGTTTCAGGGTG
>probe:Drosophila_2:1629287_at:694:425; Interrogation_Position=67; Antisense; GAGATCGAGCCCTATATGAGCCGTC
>probe:Drosophila_2:1629287_at:181:25; Interrogation_Position=80; Antisense; ATATGAGCCGTCTGCGCTACGAGTT

Paste this into a BLAST search page for me
AGTTCGATCACTGGGACGATGCCATATGCCATACACGGTTTTCGGGAGACAGAGATCCTGGAGCGCGTGCGCCAAGATGGAGCAGTTATGCCCTATGTCCTATGTCCACATCCTAGATCTTGCACATCTTGCACCCGATGGCGTTATCAAGCGGCAACACCATCTCTGGAATCAGGAATCAGCCTACTTAGCGACAGTGTGCACGGATGAGCAGCGGTACCAACAAATCGTCGGGAACTGCAACGGATCCAAGAACAACTTCTACGCTGACATCCAAGGAGCACTCCCAGTTTCAGGGTGGAGATCGAGCCCTATATGAGCCGTCATATGAGCCGTCTGCGCTACGAGTT

Full Affymetrix probeset data:

Annotations for 1629287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720