FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629289_at:

>probe:Drosophila_2:1629289_at:99:563; Interrogation_Position=1835; Antisense; GGAAGACAAGCCGACACAGCCGTCA
>probe:Drosophila_2:1629289_at:157:153; Interrogation_Position=1850; Antisense; ACAGCCGTCAAGTACGAAACCGCAT
>probe:Drosophila_2:1629289_at:518:173; Interrogation_Position=1925; Antisense; AAAGCCCCAGAAGGTTGACGAGAAG
>probe:Drosophila_2:1629289_at:660:371; Interrogation_Position=1950; Antisense; GAAGTTAAAGAGTCCTGCCCACCTT
>probe:Drosophila_2:1629289_at:120:85; Interrogation_Position=1982; Antisense; AGTGGGCTGCGCGTGCACAATTTGC
>probe:Drosophila_2:1629289_at:619:161; Interrogation_Position=1998; Antisense; ACAATTTGCGACTGCCTCTATGGCA
>probe:Drosophila_2:1629289_at:2:375; Interrogation_Position=2024; Antisense; GAAGATTCCAATTTCCCCGAAGATG
>probe:Drosophila_2:1629289_at:721:131; Interrogation_Position=2110; Antisense; ACCGGGCGTACATGGATTGCACTAG
>probe:Drosophila_2:1629289_at:20:195; Interrogation_Position=2184; Antisense; AACTGCTTCTGTCTAGATCCCAAGA
>probe:Drosophila_2:1629289_at:38:459; Interrogation_Position=2207; Antisense; GATATCCGAATACTGTGAGTGCTTG
>probe:Drosophila_2:1629289_at:715:607; Interrogation_Position=2230; Antisense; TGAGAGCTCTTCAACACTTGCAGCG
>probe:Drosophila_2:1629289_at:87:149; Interrogation_Position=2245; Antisense; ACTTGCAGCGGCTCCTTGGAAAGGA
>probe:Drosophila_2:1629289_at:510:687; Interrogation_Position=2297; Antisense; TATATTCAACCTCGATGATCTCCGG
>probe:Drosophila_2:1629289_at:504:45; Interrogation_Position=2328; Antisense; ATCGCCAACCGTATGTGCAAGTGCT

Paste this into a BLAST search page for me
GGAAGACAAGCCGACACAGCCGTCAACAGCCGTCAAGTACGAAACCGCATAAAGCCCCAGAAGGTTGACGAGAAGGAAGTTAAAGAGTCCTGCCCACCTTAGTGGGCTGCGCGTGCACAATTTGCACAATTTGCGACTGCCTCTATGGCAGAAGATTCCAATTTCCCCGAAGATGACCGGGCGTACATGGATTGCACTAGAACTGCTTCTGTCTAGATCCCAAGAGATATCCGAATACTGTGAGTGCTTGTGAGAGCTCTTCAACACTTGCAGCGACTTGCAGCGGCTCCTTGGAAAGGATATATTCAACCTCGATGATCTCCGGATCGCCAACCGTATGTGCAAGTGCT

Full Affymetrix probeset data:

Annotations for 1629289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720