FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629290_at:

>probe:Drosophila_2:1629290_at:231:341; Interrogation_Position=2574; Antisense; GCTTTTGTTCGGCTTTGTAGTGATG
>probe:Drosophila_2:1629290_at:205:601; Interrogation_Position=2597; Antisense; TGTAGTTTAAATACCCTCTGTCAGG
>probe:Drosophila_2:1629290_at:646:15; Interrogation_Position=2629; Antisense; ATTTAATTATGTCACTAGCTCTAGA
>probe:Drosophila_2:1629290_at:448:389; Interrogation_Position=2652; Antisense; GAAAAAGTACATTTCACTTGCCGAA
>probe:Drosophila_2:1629290_at:178:651; Interrogation_Position=2665; Antisense; TCACTTGCCGAAAGCTGTACAAATT
>probe:Drosophila_2:1629290_at:143:1; Interrogation_Position=2701; Antisense; AAACTACTTGAATCCTTGATGTAAC
>probe:Drosophila_2:1629290_at:240:107; Interrogation_Position=2727; Antisense; AGAACTTCCGCATCATCCAAAAATA
>probe:Drosophila_2:1629290_at:714:277; Interrogation_Position=2752; Antisense; CTATATACAGCTCTATTCATGTTGA
>probe:Drosophila_2:1629290_at:607:609; Interrogation_Position=2780; Antisense; TGACCCGAGATTCATCAGTGTTACT
>probe:Drosophila_2:1629290_at:24:649; Interrogation_Position=2794; Antisense; TCAGTGTTACTAGTCAGCAGCTCCG
>probe:Drosophila_2:1629290_at:414:353; Interrogation_Position=2810; Antisense; GCAGCTCCGCGGGATATCAAAATGA
>probe:Drosophila_2:1629290_at:579:213; Interrogation_Position=2982; Antisense; AAGAGCACACACTTACATGTGGGAT
>probe:Drosophila_2:1629290_at:299:645; Interrogation_Position=3044; Antisense; TTTGGCGTTACAAGTTTAGGACTAT
>probe:Drosophila_2:1629290_at:597:139; Interrogation_Position=3086; Antisense; ACGTGGAGAGAGTTACAGTTTTCGA

Paste this into a BLAST search page for me
GCTTTTGTTCGGCTTTGTAGTGATGTGTAGTTTAAATACCCTCTGTCAGGATTTAATTATGTCACTAGCTCTAGAGAAAAAGTACATTTCACTTGCCGAATCACTTGCCGAAAGCTGTACAAATTAAACTACTTGAATCCTTGATGTAACAGAACTTCCGCATCATCCAAAAATACTATATACAGCTCTATTCATGTTGATGACCCGAGATTCATCAGTGTTACTTCAGTGTTACTAGTCAGCAGCTCCGGCAGCTCCGCGGGATATCAAAATGAAAGAGCACACACTTACATGTGGGATTTTGGCGTTACAAGTTTAGGACTATACGTGGAGAGAGTTACAGTTTTCGA

Full Affymetrix probeset data:

Annotations for 1629290_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720