Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629295_at:

>probe:Drosophila_2:1629295_at:502:145; Interrogation_Position=4428; Antisense; ACTCCTAGATGTTAAGTGACTTCTT
>probe:Drosophila_2:1629295_at:640:511; Interrogation_Position=4443; Antisense; GTGACTTCTTCATATTGTAGCTTGT
>probe:Drosophila_2:1629295_at:636:319; Interrogation_Position=4481; Antisense; GCAAATATTTTACAGACCAATCGCA
>probe:Drosophila_2:1629295_at:434:395; Interrogation_Position=4510; Antisense; GAAATTACTTTTAATGGCAACCAGT
>probe:Drosophila_2:1629295_at:661:565; Interrogation_Position=4525; Antisense; GGCAACCAGTTGAAATCGTAACCAG
>probe:Drosophila_2:1629295_at:315:217; Interrogation_Position=4563; Antisense; AAGTATCTGGTTATTCAGGGCCCAC
>probe:Drosophila_2:1629295_at:297:265; Interrogation_Position=4578; Antisense; CAGGGCCCACAATTCGTTGTTAACT
>probe:Drosophila_2:1629295_at:422:699; Interrogation_Position=4639; Antisense; TTTTCAACTCGCGACACGAGGGACA
>probe:Drosophila_2:1629295_at:291:325; Interrogation_Position=4649; Antisense; GCGACACGAGGGACACAAGCAAAGT
>probe:Drosophila_2:1629295_at:398:221; Interrogation_Position=4670; Antisense; AAGTGAACTTTTCCAGCGTATCAGT
>probe:Drosophila_2:1629295_at:266:721; Interrogation_Position=4680; Antisense; TTCCAGCGTATCAGTGACAAGGTTT
>probe:Drosophila_2:1629295_at:439:229; Interrogation_Position=4819; Antisense; AATGTAGAAAGCAAACGCAACGTTT
>probe:Drosophila_2:1629295_at:351:477; Interrogation_Position=4906; Antisense; GTTTTTCCTACACTTATAAGATCCA
>probe:Drosophila_2:1629295_at:672:95; Interrogation_Position=4924; Antisense; AGATCCAAAACACCCTACTTACATG

Paste this into a BLAST search page for me
ACTCCTAGATGTTAAGTGACTTCTTGTGACTTCTTCATATTGTAGCTTGTGCAAATATTTTACAGACCAATCGCAGAAATTACTTTTAATGGCAACCAGTGGCAACCAGTTGAAATCGTAACCAGAAGTATCTGGTTATTCAGGGCCCACCAGGGCCCACAATTCGTTGTTAACTTTTTCAACTCGCGACACGAGGGACAGCGACACGAGGGACACAAGCAAAGTAAGTGAACTTTTCCAGCGTATCAGTTTCCAGCGTATCAGTGACAAGGTTTAATGTAGAAAGCAAACGCAACGTTTGTTTTTCCTACACTTATAAGATCCAAGATCCAAAACACCCTACTTACATG

Full Affymetrix probeset data:

Annotations for 1629295_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime