Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629296_at:

>probe:Drosophila_2:1629296_at:128:443; Interrogation_Position=109; Antisense; GATGTCGACATTGCCGGCGAGGAAA
>probe:Drosophila_2:1629296_at:270:381; Interrogation_Position=135; Antisense; GAACCTCGAGGGTCAATCTGTTTCG
>probe:Drosophila_2:1629296_at:30:459; Interrogation_Position=154; Antisense; GTTTCGAAGGAAGATCCACCGCCTG
>probe:Drosophila_2:1629296_at:52:331; Interrogation_Position=178; Antisense; GCGGCAGTTGTACCCAAAGCGACCA
>probe:Drosophila_2:1629296_at:315:101; Interrogation_Position=239; Antisense; AGAGTATGGACTATGCGGCACGGAT
>probe:Drosophila_2:1629296_at:243:355; Interrogation_Position=256; Antisense; GCACGGATCGTGAAGGTCATCAACC
>probe:Drosophila_2:1629296_at:462:647; Interrogation_Position=311; Antisense; TCATGATGATGCAATCACCACTCCC
>probe:Drosophila_2:1629296_at:145:673; Interrogation_Position=350; Antisense; TACCAGTGGTCGTGTCCACCATGAT
>probe:Drosophila_2:1629296_at:312:485; Interrogation_Position=383; Antisense; GTAGGGCACCCAAGTTGAAGCTCAA
>probe:Drosophila_2:1629296_at:629:615; Interrogation_Position=447; Antisense; TGCACACCTGGTCTACGAATATATT
>probe:Drosophila_2:1629296_at:377:365; Interrogation_Position=463; Antisense; GAATATATTATCAACCACCCCGAAT
>probe:Drosophila_2:1629296_at:729:191; Interrogation_Position=50; Antisense; AACTATCTTTGAAGGAGCTGCTCAG
>probe:Drosophila_2:1629296_at:433:73; Interrogation_Position=77; Antisense; AGGACACACTCTCTGAATTGGCTAC
>probe:Drosophila_2:1629296_at:515:729; Interrogation_Position=94; Antisense; TTGGCTACCCCGAATGATGTCGACA

Paste this into a BLAST search page for me
GATGTCGACATTGCCGGCGAGGAAAGAACCTCGAGGGTCAATCTGTTTCGGTTTCGAAGGAAGATCCACCGCCTGGCGGCAGTTGTACCCAAAGCGACCAAGAGTATGGACTATGCGGCACGGATGCACGGATCGTGAAGGTCATCAACCTCATGATGATGCAATCACCACTCCCTACCAGTGGTCGTGTCCACCATGATGTAGGGCACCCAAGTTGAAGCTCAATGCACACCTGGTCTACGAATATATTGAATATATTATCAACCACCCCGAATAACTATCTTTGAAGGAGCTGCTCAGAGGACACACTCTCTGAATTGGCTACTTGGCTACCCCGAATGATGTCGACA

Full Affymetrix probeset data:

Annotations for 1629296_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime