FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629298_at:

>probe:Drosophila_2:1629298_at:310:97; Interrogation_Position=1000; Antisense; AGATCGGCAGTCATTCTCCAGGAGA
>probe:Drosophila_2:1629298_at:170:571; Interrogation_Position=1069; Antisense; GGCTTTACTCTGCTGGTCACGGTGA
>probe:Drosophila_2:1629298_at:115:345; Interrogation_Position=1118; Antisense; GCTTGTACGAGCTGGACATGCGACT
>probe:Drosophila_2:1629298_at:615:605; Interrogation_Position=1142; Antisense; TGATCAGCAATGTCTTCTCGGCGGT
>probe:Drosophila_2:1629298_at:533:597; Interrogation_Position=1202; Antisense; TGTCCCAGCGCTTCAAGATGCAATA
>probe:Drosophila_2:1629298_at:583:161; Interrogation_Position=682; Antisense; AAATACTACCGCATGCAGCGATTTT
>probe:Drosophila_2:1629298_at:482:393; Interrogation_Position=770; Antisense; GAAAGTATCTGACCCCAATGTCCTT
>probe:Drosophila_2:1629298_at:246:231; Interrogation_Position=786; Antisense; AATGTCCTTGTCCATGATTCTGTCG
>probe:Drosophila_2:1629298_at:151:23; Interrogation_Position=814; Antisense; ATATGCCACCTGCTCGGAATAACGG
>probe:Drosophila_2:1629298_at:556:139; Interrogation_Position=835; Antisense; ACGGTGGGTTTCTACAGTCTGTACT
>probe:Drosophila_2:1629298_at:673:489; Interrogation_Position=855; Antisense; GTACTATGCCATAGCGGACACCTTA
>probe:Drosophila_2:1629298_at:345:269; Interrogation_Position=882; Antisense; CATGGGCAAGCCGTACGATGGTCTT
>probe:Drosophila_2:1629298_at:354:43; Interrogation_Position=909; Antisense; ATCGCTGATCAATCTGGTTTTCCTC
>probe:Drosophila_2:1629298_at:352:551; Interrogation_Position=948; Antisense; GGAGATCACATTGCTCACGCATTTG

Paste this into a BLAST search page for me
AGATCGGCAGTCATTCTCCAGGAGAGGCTTTACTCTGCTGGTCACGGTGAGCTTGTACGAGCTGGACATGCGACTTGATCAGCAATGTCTTCTCGGCGGTTGTCCCAGCGCTTCAAGATGCAATAAAATACTACCGCATGCAGCGATTTTGAAAGTATCTGACCCCAATGTCCTTAATGTCCTTGTCCATGATTCTGTCGATATGCCACCTGCTCGGAATAACGGACGGTGGGTTTCTACAGTCTGTACTGTACTATGCCATAGCGGACACCTTACATGGGCAAGCCGTACGATGGTCTTATCGCTGATCAATCTGGTTTTCCTCGGAGATCACATTGCTCACGCATTTG

Full Affymetrix probeset data:

Annotations for 1629298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720