FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629299_at:

>probe:Drosophila_2:1629299_at:44:163; Interrogation_Position=1073; Antisense; AAATCAAGGGTCAGTTCTCTAAGAA
>probe:Drosophila_2:1629299_at:93:203; Interrogation_Position=511; Antisense; AAGCGTCCCAATAATCTTCTAGTCC
>probe:Drosophila_2:1629299_at:311:237; Interrogation_Position=523; Antisense; AATCTTCTAGTCCTGATGGCATTTA
>probe:Drosophila_2:1629299_at:686:439; Interrogation_Position=537; Antisense; GATGGCATTTATCCCACATTCAATT
>probe:Drosophila_2:1629299_at:612:417; Interrogation_Position=592; Antisense; GAGCGTATTACCAGTGATTGCCAAA
>probe:Drosophila_2:1629299_at:271:553; Interrogation_Position=687; Antisense; GGACGGAGTGCAACTTTCGGGATAT
>probe:Drosophila_2:1629299_at:463:179; Interrogation_Position=712; Antisense; AAAACCGTCGTGTGGGATATTCAGC
>probe:Drosophila_2:1629299_at:719:543; Interrogation_Position=726; Antisense; GGATATTCAGCCAACAGATCGAGTT
>probe:Drosophila_2:1629299_at:249:121; Interrogation_Position=763; Antisense; AGCGTTCAGTACTTCGATCGTGGCA
>probe:Drosophila_2:1629299_at:472:223; Interrogation_Position=820; Antisense; AAGGACTTTTGCCACGTTCTATTCG
>probe:Drosophila_2:1629299_at:194:493; Interrogation_Position=875; Antisense; GTAAGCATATAACCAATTCCGCACA
>probe:Drosophila_2:1629299_at:632:163; Interrogation_Position=903; Antisense; AAATAACACATGCTTTCGAGTCAAA
>probe:Drosophila_2:1629299_at:476:241; Interrogation_Position=981; Antisense; AATACCATTGCACAGAGGCCGCTAT
>probe:Drosophila_2:1629299_at:222:71; Interrogation_Position=996; Antisense; AGGCCGCTATGCAATCCGTTTGAAG

Paste this into a BLAST search page for me
AAATCAAGGGTCAGTTCTCTAAGAAAAGCGTCCCAATAATCTTCTAGTCCAATCTTCTAGTCCTGATGGCATTTAGATGGCATTTATCCCACATTCAATTGAGCGTATTACCAGTGATTGCCAAAGGACGGAGTGCAACTTTCGGGATATAAAACCGTCGTGTGGGATATTCAGCGGATATTCAGCCAACAGATCGAGTTAGCGTTCAGTACTTCGATCGTGGCAAAGGACTTTTGCCACGTTCTATTCGGTAAGCATATAACCAATTCCGCACAAAATAACACATGCTTTCGAGTCAAAAATACCATTGCACAGAGGCCGCTATAGGCCGCTATGCAATCCGTTTGAAG

Full Affymetrix probeset data:

Annotations for 1629299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720