FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629302_at:

>probe:Drosophila_2:1629302_at:17:189; Interrogation_Position=113; Antisense; AACATTCTCTGGGACTAAGCAACTT
>probe:Drosophila_2:1629302_at:379:109; Interrogation_Position=130; Antisense; AGCAACTTTTCACGTTAAGCTCGCC
>probe:Drosophila_2:1629302_at:229:553; Interrogation_Position=165; Antisense; GGACCCACGTCCTTTGGCGGTAGTG
>probe:Drosophila_2:1629302_at:320:507; Interrogation_Position=187; Antisense; GTGCGGCTATTACTCGCGTTTGGAA
>probe:Drosophila_2:1629302_at:219:299; Interrogation_Position=265; Antisense; CGCCAACTTATTCGGAGTCCTTAGA
>probe:Drosophila_2:1629302_at:405:373; Interrogation_Position=293; Antisense; GAAGATCATGAAACGCCGTCGTCTG
>probe:Drosophila_2:1629302_at:403:501; Interrogation_Position=310; Antisense; GTCGTCTGTACGCTCTTTTAAATAG
>probe:Drosophila_2:1629302_at:600:393; Interrogation_Position=440; Antisense; GAAATCGCCTACGAAACCAGTTATG
>probe:Drosophila_2:1629302_at:487:683; Interrogation_Position=461; Antisense; TATGCGAACATTCTACTTCTCGGAG
>probe:Drosophila_2:1629302_at:692:415; Interrogation_Position=483; Antisense; GAGCCTATACCGCTAATGCAACATA
>probe:Drosophila_2:1629302_at:335:719; Interrogation_Position=530; Antisense; TTCCGACCCAATTCCTCTGGATTAG
>probe:Drosophila_2:1629302_at:222:265; Interrogation_Position=57; Antisense; CAGAAGGGTATGAGCGACGCCACTA
>probe:Drosophila_2:1629302_at:107:411; Interrogation_Position=72; Antisense; GACGCCACTAGTAGCGACTTACGTA
>probe:Drosophila_2:1629302_at:36:493; Interrogation_Position=94; Antisense; GTAACGAGTCAGCACATCCAACATT

Paste this into a BLAST search page for me
AACATTCTCTGGGACTAAGCAACTTAGCAACTTTTCACGTTAAGCTCGCCGGACCCACGTCCTTTGGCGGTAGTGGTGCGGCTATTACTCGCGTTTGGAACGCCAACTTATTCGGAGTCCTTAGAGAAGATCATGAAACGCCGTCGTCTGGTCGTCTGTACGCTCTTTTAAATAGGAAATCGCCTACGAAACCAGTTATGTATGCGAACATTCTACTTCTCGGAGGAGCCTATACCGCTAATGCAACATATTCCGACCCAATTCCTCTGGATTAGCAGAAGGGTATGAGCGACGCCACTAGACGCCACTAGTAGCGACTTACGTAGTAACGAGTCAGCACATCCAACATT

Full Affymetrix probeset data:

Annotations for 1629302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720