FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629303_at:

>probe:Drosophila_2:1629303_at:373:725; Interrogation_Position=127; Antisense; TTGATAAATTTGTTCCAGGCGCAGT
>probe:Drosophila_2:1629303_at:97:71; Interrogation_Position=143; Antisense; AGGCGCAGTTCAGCCACTTTGGCAA
>probe:Drosophila_2:1629303_at:509:697; Interrogation_Position=210; Antisense; TTTAAATGGTCCTTGGTGCTGGCTG
>probe:Drosophila_2:1629303_at:703:287; Interrogation_Position=228; Antisense; CTGGCTGGGCTGAGCGATACGCTAA
>probe:Drosophila_2:1629303_at:399:631; Interrogation_Position=257; Antisense; TCCTCCTGCCAATATATCGCTGAAT
>probe:Drosophila_2:1629303_at:573:43; Interrogation_Position=272; Antisense; ATCGCTGAATCAATGCGGCTCCTTG
>probe:Drosophila_2:1629303_at:604:629; Interrogation_Position=291; Antisense; TCCTTGGCAGTCACGGGCTTAATTT
>probe:Drosophila_2:1629303_at:320:571; Interrogation_Position=306; Antisense; GGCTTAATTTGGTCTCGCTACTCAG
>probe:Drosophila_2:1629303_at:690:339; Interrogation_Position=322; Antisense; GCTACTCAGTGGTTATCACACCCAA
>probe:Drosophila_2:1629303_at:583:107; Interrogation_Position=346; Antisense; AGAACTACAATCTTCTGGCCGTCAA
>probe:Drosophila_2:1629303_at:156:499; Interrogation_Position=378; Antisense; GTCTTTCTCATCCAGGGTTATCTAA
>probe:Drosophila_2:1629303_at:696:191; Interrogation_Position=432; Antisense; AACTCTCGGAATGCGGTGTTCAATC
>probe:Drosophila_2:1629303_at:399:11; Interrogation_Position=457; Antisense; ATTCGCACTACCCAATCAAATCAGG
>probe:Drosophila_2:1629303_at:188:343; Interrogation_Position=82; Antisense; GCACGGGACCCTTGTCTAAGTTGTA

Paste this into a BLAST search page for me
TTGATAAATTTGTTCCAGGCGCAGTAGGCGCAGTTCAGCCACTTTGGCAATTTAAATGGTCCTTGGTGCTGGCTGCTGGCTGGGCTGAGCGATACGCTAATCCTCCTGCCAATATATCGCTGAATATCGCTGAATCAATGCGGCTCCTTGTCCTTGGCAGTCACGGGCTTAATTTGGCTTAATTTGGTCTCGCTACTCAGGCTACTCAGTGGTTATCACACCCAAAGAACTACAATCTTCTGGCCGTCAAGTCTTTCTCATCCAGGGTTATCTAAAACTCTCGGAATGCGGTGTTCAATCATTCGCACTACCCAATCAAATCAGGGCACGGGACCCTTGTCTAAGTTGTA

Full Affymetrix probeset data:

Annotations for 1629303_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720