FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629304_at:

>probe:Drosophila_2:1629304_at:663:369; Interrogation_Position=330; Antisense; GAATGGCTACGACTACTCGGAACCC
>probe:Drosophila_2:1629304_at:472:313; Interrogation_Position=450; Antisense; GCCAGGCGATGACCATGTCCACGTG
>probe:Drosophila_2:1629304_at:578:303; Interrogation_Position=476; Antisense; CCGGCATGCCGTACGACTTCGAGTA
>probe:Drosophila_2:1629304_at:639:89; Interrogation_Position=497; Antisense; AGTACGCCGTTCAGGATCCGGAGAC
>probe:Drosophila_2:1629304_at:688:551; Interrogation_Position=516; Antisense; GGAGACCGCCAACGATTATGCGCAC
>probe:Drosophila_2:1629304_at:37:705; Interrogation_Position=531; Antisense; TTATGCGCACAAGGCGTCCAGTGAT
>probe:Drosophila_2:1629304_at:164:611; Interrogation_Position=566; Antisense; TGACCGGCGAGTACCGCGTCCAGAT
>probe:Drosophila_2:1629304_at:232:97; Interrogation_Position=587; Antisense; AGATGCCCGACGGAAGGACCCAGAT
>probe:Drosophila_2:1629304_at:717:559; Interrogation_Position=598; Antisense; GGAAGGACCCAGATCGTCCGCTACA
>probe:Drosophila_2:1629304_at:137:667; Interrogation_Position=619; Antisense; TACACCGCCGACTGGAAGACGGGCT
>probe:Drosophila_2:1629304_at:542:673; Interrogation_Position=643; Antisense; TACCACGCGGACGTGAGCTACGAGG
>probe:Drosophila_2:1629304_at:105:531; Interrogation_Position=787; Antisense; GGGTCACATATGTATCTTGCGAAAC
>probe:Drosophila_2:1629304_at:176:483; Interrogation_Position=798; Antisense; GTATCTTGCGAAACGTGTAAGCCTT
>probe:Drosophila_2:1629304_at:693:513; Interrogation_Position=812; Antisense; GTGTAAGCCTTACGATATACCAATA

Paste this into a BLAST search page for me
GAATGGCTACGACTACTCGGAACCCGCCAGGCGATGACCATGTCCACGTGCCGGCATGCCGTACGACTTCGAGTAAGTACGCCGTTCAGGATCCGGAGACGGAGACCGCCAACGATTATGCGCACTTATGCGCACAAGGCGTCCAGTGATTGACCGGCGAGTACCGCGTCCAGATAGATGCCCGACGGAAGGACCCAGATGGAAGGACCCAGATCGTCCGCTACATACACCGCCGACTGGAAGACGGGCTTACCACGCGGACGTGAGCTACGAGGGGGTCACATATGTATCTTGCGAAACGTATCTTGCGAAACGTGTAAGCCTTGTGTAAGCCTTACGATATACCAATA

Full Affymetrix probeset data:

Annotations for 1629304_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720