Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629305_at:

>probe:Drosophila_2:1629305_at:448:113; Interrogation_Position=4786; Antisense; AGCAGCTCTGGTGGATTTGGCTCCT
>probe:Drosophila_2:1629305_at:384:21; Interrogation_Position=4800; Antisense; ATTTGGCTCCTTCACGCAGACGACA
>probe:Drosophila_2:1629305_at:220:265; Interrogation_Position=4882; Antisense; CAGACAGGTTTTGGCTCACCACAAG
>probe:Drosophila_2:1629305_at:684:351; Interrogation_Position=4911; Antisense; GCAGCAGCAAACTACGACACCAGGT
>probe:Drosophila_2:1629305_at:135:149; Interrogation_Position=4927; Antisense; ACACCAGGTGGGTTTGGAGCCAAGC
>probe:Drosophila_2:1629305_at:230:553; Interrogation_Position=4942; Antisense; GGAGCCAAGCCCGTTTTCGGTGGAT
>probe:Drosophila_2:1629305_at:188:589; Interrogation_Position=4962; Antisense; TGGATCCCCGGCCTTTGGAGCTAGC
>probe:Drosophila_2:1629305_at:229:435; Interrogation_Position=5000; Antisense; GAGGTGCCACCTTTGGCAGTCCGAA
>probe:Drosophila_2:1629305_at:638:589; Interrogation_Position=5034; Antisense; TGGATTTGGCGGTGCCAGCCCAGTA
>probe:Drosophila_2:1629305_at:55:729; Interrogation_Position=5075; Antisense; TTGGTGCTGCTGCAAAGCCGGCACA
>probe:Drosophila_2:1629305_at:293:117; Interrogation_Position=5090; Antisense; AGCCGGCACAGGGAAACATTTTTGA
>probe:Drosophila_2:1629305_at:557:235; Interrogation_Position=5132; Antisense; AATCGGGACTCTCTTTCGGAAATCT
>probe:Drosophila_2:1629305_at:87:329; Interrogation_Position=5191; Antisense; GCGTTTGGCGGATCGAGCTTTATGA
>probe:Drosophila_2:1629305_at:274:679; Interrogation_Position=5256; Antisense; TAGTTTTGCTTGTTCAGTTTTCATG

Paste this into a BLAST search page for me
AGCAGCTCTGGTGGATTTGGCTCCTATTTGGCTCCTTCACGCAGACGACACAGACAGGTTTTGGCTCACCACAAGGCAGCAGCAAACTACGACACCAGGTACACCAGGTGGGTTTGGAGCCAAGCGGAGCCAAGCCCGTTTTCGGTGGATTGGATCCCCGGCCTTTGGAGCTAGCGAGGTGCCACCTTTGGCAGTCCGAATGGATTTGGCGGTGCCAGCCCAGTATTGGTGCTGCTGCAAAGCCGGCACAAGCCGGCACAGGGAAACATTTTTGAAATCGGGACTCTCTTTCGGAAATCTGCGTTTGGCGGATCGAGCTTTATGATAGTTTTGCTTGTTCAGTTTTCATG

Full Affymetrix probeset data:

Annotations for 1629305_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime