FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629306_at:

>probe:Drosophila_2:1629306_at:103:243; Interrogation_Position=3930; Antisense; AATTGTTCGTCGTCAAATCGTTCAG
>probe:Drosophila_2:1629306_at:639:165; Interrogation_Position=3944; Antisense; AAATCGTTCAGGTGTCCACAGCGAC
>probe:Drosophila_2:1629306_at:500:155; Interrogation_Position=3961; Antisense; ACAGCGACCACAACTGCAATAGAGA
>probe:Drosophila_2:1629306_at:134:263; Interrogation_Position=4006; Antisense; CAGAAAATGCTACTTTTTGGTTCAT
>probe:Drosophila_2:1629306_at:49:541; Interrogation_Position=4024; Antisense; GGTTCATTTTGTCCATCTGTGTACA
>probe:Drosophila_2:1629306_at:351:175; Interrogation_Position=4066; Antisense; AAAGCCAGTGCGAGTGTATGTGAGC
>probe:Drosophila_2:1629306_at:220:3; Interrogation_Position=4114; Antisense; ATTGTAAACGCATTGTCCCGAAAAT
>probe:Drosophila_2:1629306_at:11:345; Interrogation_Position=4123; Antisense; GCATTGTCCCGAAAATACCAACCTT
>probe:Drosophila_2:1629306_at:155:307; Interrogation_Position=4157; Antisense; CCTCGCATCCATTAGCTTAAGCATT
>probe:Drosophila_2:1629306_at:364:453; Interrogation_Position=4218; Antisense; GATCTAATCCATTATTTGTCATGTA
>probe:Drosophila_2:1629306_at:407:183; Interrogation_Position=4299; Antisense; AAAAGCAACACACCTTATGCCAAAA
>probe:Drosophila_2:1629306_at:168:703; Interrogation_Position=4347; Antisense; TTATTGTATAGAGCCATTGCGGATA
>probe:Drosophila_2:1629306_at:17:245; Interrogation_Position=4371; Antisense; AATTATTGCAATACCATTACCGATA
>probe:Drosophila_2:1629306_at:417:389; Interrogation_Position=4418; Antisense; GAAAAACGAAGCCATGCCTGCAAAA

Paste this into a BLAST search page for me
AATTGTTCGTCGTCAAATCGTTCAGAAATCGTTCAGGTGTCCACAGCGACACAGCGACCACAACTGCAATAGAGACAGAAAATGCTACTTTTTGGTTCATGGTTCATTTTGTCCATCTGTGTACAAAAGCCAGTGCGAGTGTATGTGAGCATTGTAAACGCATTGTCCCGAAAATGCATTGTCCCGAAAATACCAACCTTCCTCGCATCCATTAGCTTAAGCATTGATCTAATCCATTATTTGTCATGTAAAAAGCAACACACCTTATGCCAAAATTATTGTATAGAGCCATTGCGGATAAATTATTGCAATACCATTACCGATAGAAAAACGAAGCCATGCCTGCAAAA

Full Affymetrix probeset data:

Annotations for 1629306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720