FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629308_at:

>probe:Drosophila_2:1629308_at:607:467; Interrogation_Position=427; Antisense; GTTGACTATGCCATGTCCGTACGAG
>probe:Drosophila_2:1629308_at:245:457; Interrogation_Position=511; Antisense; GATATGTCACTTGAAACCCTTGAGG
>probe:Drosophila_2:1629308_at:27:277; Interrogation_Position=637; Antisense; CTTTTCAGCTACGATAACCCGGACA
>probe:Drosophila_2:1629308_at:158:289; Interrogation_Position=656; Antisense; CGGACAAGCGTCTATCTAGCGAAGA
>probe:Drosophila_2:1629308_at:259:125; Interrogation_Position=734; Antisense; AGCCCATTGGAAAAGCCGCATTCTA
>probe:Drosophila_2:1629308_at:88:485; Interrogation_Position=793; Antisense; GTAGACCTTGCAGGAACTTGTTCCC
>probe:Drosophila_2:1629308_at:122:509; Interrogation_Position=824; Antisense; GGTCCGTGATTTACTACGCCGAGGC
>probe:Drosophila_2:1629308_at:479:317; Interrogation_Position=841; Antisense; GCCGAGGCCATCACCGAGAATAGTT
>probe:Drosophila_2:1629308_at:402:419; Interrogation_Position=869; Antisense; GAGCTATCCAGTGCCAGGACTACCA
>probe:Drosophila_2:1629308_at:134:75; Interrogation_Position=884; Antisense; AGGACTACCAGGCTGCTCTGGACAA
>probe:Drosophila_2:1629308_at:517:231; Interrogation_Position=907; Antisense; AATGAGTGTGGCAGCTCCTTCAGCA
>probe:Drosophila_2:1629308_at:391:113; Interrogation_Position=928; Antisense; AGCAGCGTCCGCATGGCAGAGGATA
>probe:Drosophila_2:1629308_at:61:83; Interrogation_Position=971; Antisense; AGGGCCACTTCTATGTGCCTGTAAA
>probe:Drosophila_2:1629308_at:435:189; Interrogation_Position=994; Antisense; AACAGTGAGGCTCCATTCGGGCAAA

Paste this into a BLAST search page for me
GTTGACTATGCCATGTCCGTACGAGGATATGTCACTTGAAACCCTTGAGGCTTTTCAGCTACGATAACCCGGACACGGACAAGCGTCTATCTAGCGAAGAAGCCCATTGGAAAAGCCGCATTCTAGTAGACCTTGCAGGAACTTGTTCCCGGTCCGTGATTTACTACGCCGAGGCGCCGAGGCCATCACCGAGAATAGTTGAGCTATCCAGTGCCAGGACTACCAAGGACTACCAGGCTGCTCTGGACAAAATGAGTGTGGCAGCTCCTTCAGCAAGCAGCGTCCGCATGGCAGAGGATAAGGGCCACTTCTATGTGCCTGTAAAAACAGTGAGGCTCCATTCGGGCAAA

Full Affymetrix probeset data:

Annotations for 1629308_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720