Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629309_at:

>probe:Drosophila_2:1629309_at:181:623; Interrogation_Position=3659; Antisense; TGCGTGAAAATCGTATCCTGGTAAT
>probe:Drosophila_2:1629309_at:292:589; Interrogation_Position=3677; Antisense; TGGTAATGGACGAGGCTACGGCCAA
>probe:Drosophila_2:1629309_at:448:589; Interrogation_Position=3704; Antisense; TGGATCCCCAGACAGATGGCCTCAT
>probe:Drosophila_2:1629309_at:36:511; Interrogation_Position=3759; Antisense; GTGCACTGTGCTGACGATAGCTCAT
>probe:Drosophila_2:1629309_at:537:457; Interrogation_Position=3774; Antisense; GATAGCTCATCGTTTGCACACCATC
>probe:Drosophila_2:1629309_at:332:585; Interrogation_Position=3849; Antisense; TGGAACGCCCTATGAACTGCTGACG
>probe:Drosophila_2:1629309_at:107:195; Interrogation_Position=3863; Antisense; AACTGCTGACGCTGGCGGATTCTAA
>probe:Drosophila_2:1629309_at:481:321; Interrogation_Position=3877; Antisense; GCGGATTCTAAGGTGTTCCACGGTA
>probe:Drosophila_2:1629309_at:382:613; Interrogation_Position=3905; Antisense; TGAAGCAAACGGGTCACGCCACCTA
>probe:Drosophila_2:1629309_at:55:135; Interrogation_Position=3920; Antisense; ACGCCACCTATGAGAGTCTGCTGAA
>probe:Drosophila_2:1629309_at:97:367; Interrogation_Position=3975; Antisense; GAATCACAGTCTTTCCTCGTGAGAA
>probe:Drosophila_2:1629309_at:495:263; Interrogation_Position=4001; Antisense; CAGCTATTATGTGTTTGTCACCGAA
>probe:Drosophila_2:1629309_at:463:495; Interrogation_Position=4017; Antisense; GTCACCGAATCTTTAGCTGGCTAAT
>probe:Drosophila_2:1629309_at:437:395; Interrogation_Position=4230; Antisense; GAAATATTTTCTCTGTTCCTAATCT

Paste this into a BLAST search page for me
TGCGTGAAAATCGTATCCTGGTAATTGGTAATGGACGAGGCTACGGCCAATGGATCCCCAGACAGATGGCCTCATGTGCACTGTGCTGACGATAGCTCATGATAGCTCATCGTTTGCACACCATCTGGAACGCCCTATGAACTGCTGACGAACTGCTGACGCTGGCGGATTCTAAGCGGATTCTAAGGTGTTCCACGGTATGAAGCAAACGGGTCACGCCACCTAACGCCACCTATGAGAGTCTGCTGAAGAATCACAGTCTTTCCTCGTGAGAACAGCTATTATGTGTTTGTCACCGAAGTCACCGAATCTTTAGCTGGCTAATGAAATATTTTCTCTGTTCCTAATCT

Full Affymetrix probeset data:

Annotations for 1629309_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime