Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629310_at:

>probe:Drosophila_2:1629310_at:606:547; Interrogation_Position=2918; Antisense; GGAGGTAATGGCTTCATCCGACCGG
>probe:Drosophila_2:1629310_at:209:511; Interrogation_Position=2943; Antisense; GTGACGTCGGCACCGGTTCCAACAG
>probe:Drosophila_2:1629310_at:477:83; Interrogation_Position=2984; Antisense; AGTGGCGGCCGCAATTACAACCAGC
>probe:Drosophila_2:1629310_at:389:187; Interrogation_Position=3069; Antisense; AACAGCAGCTGAGCAAGTCCAACTC
>probe:Drosophila_2:1629310_at:115:315; Interrogation_Position=3132; Antisense; GCCATGGCAATCATAGTCACCGACA
>probe:Drosophila_2:1629310_at:125:525; Interrogation_Position=3214; Antisense; GGGCGGCGGCAATCGATACCAGAAA
>probe:Drosophila_2:1629310_at:314:129; Interrogation_Position=3231; Antisense; ACCAGAAATCGTTGGGCGGATCGCC
>probe:Drosophila_2:1629310_at:179:451; Interrogation_Position=3249; Antisense; GATCGCCCATCATCAGTGCTGGCAA
>probe:Drosophila_2:1629310_at:651:35; Interrogation_Position=3260; Antisense; ATCAGTGCTGGCAATGCGTCGAACA
>probe:Drosophila_2:1629310_at:107:567; Interrogation_Position=3353; Antisense; GGCACGCTGGTCAACTCATCGTCAG
>probe:Drosophila_2:1629310_at:471:685; Interrogation_Position=3381; Antisense; TATCAATCATTTCCATATCCTCAGA
>probe:Drosophila_2:1629310_at:61:265; Interrogation_Position=3402; Antisense; CAGAATCATCCATTGCTAGCAGCAG
>probe:Drosophila_2:1629310_at:203:261; Interrogation_Position=3430; Antisense; CAGTTCGTCAAGATCCGGTCAGGAT
>probe:Drosophila_2:1629310_at:213:649; Interrogation_Position=3448; Antisense; TCAGGATCAGCAGCGTGACGAGCGA

Paste this into a BLAST search page for me
GGAGGTAATGGCTTCATCCGACCGGGTGACGTCGGCACCGGTTCCAACAGAGTGGCGGCCGCAATTACAACCAGCAACAGCAGCTGAGCAAGTCCAACTCGCCATGGCAATCATAGTCACCGACAGGGCGGCGGCAATCGATACCAGAAAACCAGAAATCGTTGGGCGGATCGCCGATCGCCCATCATCAGTGCTGGCAAATCAGTGCTGGCAATGCGTCGAACAGGCACGCTGGTCAACTCATCGTCAGTATCAATCATTTCCATATCCTCAGACAGAATCATCCATTGCTAGCAGCAGCAGTTCGTCAAGATCCGGTCAGGATTCAGGATCAGCAGCGTGACGAGCGA

Full Affymetrix probeset data:

Annotations for 1629310_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime