FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629311_at:

>probe:Drosophila_2:1629311_at:75:727; Interrogation_Position=313; Antisense; TTGGACCAGGGTGATAGCCTCATCC
>probe:Drosophila_2:1629311_at:531:677; Interrogation_Position=359; Antisense; TAGTCTCCAAGCTGCGGGAAATCTT
>probe:Drosophila_2:1629311_at:589:527; Interrogation_Position=374; Antisense; GGGAAATCTTTACGAGTGCCTCCTC
>probe:Drosophila_2:1629311_at:340:625; Interrogation_Position=390; Antisense; TGCCTCCTCGTATACCGACAAAATG
>probe:Drosophila_2:1629311_at:552:615; Interrogation_Position=434; Antisense; TGAATGCTGCAATGGCGCCTGGGTC
>probe:Drosophila_2:1629311_at:309:591; Interrogation_Position=464; Antisense; TGGTGCAGAAGCTCCTAACCGGCTG
>probe:Drosophila_2:1629311_at:82:439; Interrogation_Position=508; Antisense; GAGGAACAGATCTACCAGTCCCAGA
>probe:Drosophila_2:1629311_at:488:385; Interrogation_Position=546; Antisense; GAACTTCCTCATGATCGACTTTATG
>probe:Drosophila_2:1629311_at:317:149; Interrogation_Position=563; Antisense; ACTTTATGCGAGATGCCTGCGTGGA
>probe:Drosophila_2:1629311_at:185:307; Interrogation_Position=578; Antisense; CCTGCGTGGAGGTGCTGCTGAACAA
>probe:Drosophila_2:1629311_at:393:435; Interrogation_Position=610; Antisense; GAGGTGGCCAAATCTGATCGAGTCA
>probe:Drosophila_2:1629311_at:170:451; Interrogation_Position=720; Antisense; GATCTACAGTCGCATCGAGGTCATT
>probe:Drosophila_2:1629311_at:98:79; Interrogation_Position=737; Antisense; AGGTCATTTTCAACAGGGCTACGGA
>probe:Drosophila_2:1629311_at:622:455; Interrogation_Position=798; Antisense; GATACTCGATGCCAGTATGCACGAT

Paste this into a BLAST search page for me
TTGGACCAGGGTGATAGCCTCATCCTAGTCTCCAAGCTGCGGGAAATCTTGGGAAATCTTTACGAGTGCCTCCTCTGCCTCCTCGTATACCGACAAAATGTGAATGCTGCAATGGCGCCTGGGTCTGGTGCAGAAGCTCCTAACCGGCTGGAGGAACAGATCTACCAGTCCCAGAGAACTTCCTCATGATCGACTTTATGACTTTATGCGAGATGCCTGCGTGGACCTGCGTGGAGGTGCTGCTGAACAAGAGGTGGCCAAATCTGATCGAGTCAGATCTACAGTCGCATCGAGGTCATTAGGTCATTTTCAACAGGGCTACGGAGATACTCGATGCCAGTATGCACGAT

Full Affymetrix probeset data:

Annotations for 1629311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720