FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629312_at:

>probe:Drosophila_2:1629312_at:138:477; Interrogation_Position=111; Antisense; GTTATCCGAATATGAAGCCCACCAA
>probe:Drosophila_2:1629312_at:506:587; Interrogation_Position=140; Antisense; TGGAGAATTGGCCAGTTCCGCCCAT
>probe:Drosophila_2:1629312_at:309:465; Interrogation_Position=15; Antisense; GTTGGACCAACTTACACTGTGTTTG
>probe:Drosophila_2:1629312_at:529:43; Interrogation_Position=163; Antisense; ATCGATCGGGCTTACAAATGCTTTC
>probe:Drosophila_2:1629312_at:412:167; Interrogation_Position=178; Antisense; AAATGCTTTCTAACATGCGTCCTCT
>probe:Drosophila_2:1629312_at:481:291; Interrogation_Position=195; Antisense; CGTCCTCTTGGATTTGGGTCTGATT
>probe:Drosophila_2:1629312_at:411:295; Interrogation_Position=321; Antisense; CGACGAAAGGGATCTGTGCGAGCTA
>probe:Drosophila_2:1629312_at:691:505; Interrogation_Position=336; Antisense; GTGCGAGCTATCATATGGAATCTTC
>probe:Drosophila_2:1629312_at:257:481; Interrogation_Position=35; Antisense; GTTTGTTGCTAAATTTTCTGTGCGC
>probe:Drosophila_2:1629312_at:134:565; Interrogation_Position=352; Antisense; GGAATCTTCAACTGCTTCAAGGATG
>probe:Drosophila_2:1629312_at:507:653; Interrogation_Position=368; Antisense; TCAAGGATGTGAAGCTTGCGGCCGA
>probe:Drosophila_2:1629312_at:317:17; Interrogation_Position=47; Antisense; ATTTTCTGTGCGCAAATGTTCTCGC
>probe:Drosophila_2:1629312_at:551:59; Interrogation_Position=62; Antisense; ATGTTCTCGCTAACACTTCAGTATT
>probe:Drosophila_2:1629312_at:621:481; Interrogation_Position=82; Antisense; GTATTTAATCCGTGTGTTTCGCAAA

Paste this into a BLAST search page for me
GTTATCCGAATATGAAGCCCACCAATGGAGAATTGGCCAGTTCCGCCCATGTTGGACCAACTTACACTGTGTTTGATCGATCGGGCTTACAAATGCTTTCAAATGCTTTCTAACATGCGTCCTCTCGTCCTCTTGGATTTGGGTCTGATTCGACGAAAGGGATCTGTGCGAGCTAGTGCGAGCTATCATATGGAATCTTCGTTTGTTGCTAAATTTTCTGTGCGCGGAATCTTCAACTGCTTCAAGGATGTCAAGGATGTGAAGCTTGCGGCCGAATTTTCTGTGCGCAAATGTTCTCGCATGTTCTCGCTAACACTTCAGTATTGTATTTAATCCGTGTGTTTCGCAAA

Full Affymetrix probeset data:

Annotations for 1629312_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720