FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629313_at:

>probe:Drosophila_2:1629313_at:678:401; Interrogation_Position=152; Antisense; GACTTTGGCGTGCTGAGTACGACCT
>probe:Drosophila_2:1629313_at:89:431; Interrogation_Position=166; Antisense; GAGTACGACCTACAAATCCCTAAAG
>probe:Drosophila_2:1629313_at:717:653; Interrogation_Position=225; Antisense; TAATCAAGTGGGTGGCGGGCATCAA
>probe:Drosophila_2:1629313_at:599:623; Interrogation_Position=256; Antisense; TGCGACCCAATTTAACACGGACGTG
>probe:Drosophila_2:1629313_at:499:31; Interrogation_Position=336; Antisense; ATAAGATCCTCAGCACTTGCAACGA
>probe:Drosophila_2:1629313_at:549:149; Interrogation_Position=350; Antisense; ACTTGCAACGACCTCATCAATCTGA
>probe:Drosophila_2:1629313_at:406:33; Interrogation_Position=365; Antisense; ATCAATCTGAGGTCCAACACTTGCC
>probe:Drosophila_2:1629313_at:28:105; Interrogation_Position=408; Antisense; AGACGAAGGTCTCTGGCAGCTGCTT
>probe:Drosophila_2:1629313_at:528:335; Interrogation_Position=426; Antisense; GCTGCTTTGTTAAGACTCTGCGCAA
>probe:Drosophila_2:1629313_at:128:405; Interrogation_Position=439; Antisense; GACTCTGCGCAAGGTGTGGTCCCTA
>probe:Drosophila_2:1629313_at:46:581; Interrogation_Position=492; Antisense; TGGCCAAGAAGATCCCGCAAACCGG
>probe:Drosophila_2:1629313_at:700:333; Interrogation_Position=597; Antisense; GCTGCTCCAAGCTGACTTCTTAGGG
>probe:Drosophila_2:1629313_at:258:679; Interrogation_Position=625; Antisense; TAGTGCCCGCAATTGATTCGAGCAT
>probe:Drosophila_2:1629313_at:246:305; Interrogation_Position=97; Antisense; CCTGGACTCTTCGTCAGAACTGGAC

Paste this into a BLAST search page for me
GACTTTGGCGTGCTGAGTACGACCTGAGTACGACCTACAAATCCCTAAAGTAATCAAGTGGGTGGCGGGCATCAATGCGACCCAATTTAACACGGACGTGATAAGATCCTCAGCACTTGCAACGAACTTGCAACGACCTCATCAATCTGAATCAATCTGAGGTCCAACACTTGCCAGACGAAGGTCTCTGGCAGCTGCTTGCTGCTTTGTTAAGACTCTGCGCAAGACTCTGCGCAAGGTGTGGTCCCTATGGCCAAGAAGATCCCGCAAACCGGGCTGCTCCAAGCTGACTTCTTAGGGTAGTGCCCGCAATTGATTCGAGCATCCTGGACTCTTCGTCAGAACTGGAC

Full Affymetrix probeset data:

Annotations for 1629313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720