FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629316_at:

>probe:Drosophila_2:1629316_at:499:475; Interrogation_Position=1003; Antisense; GTTTTGACGGTTAGCGTTCTCCACT
>probe:Drosophila_2:1629316_at:615:471; Interrogation_Position=1018; Antisense; GTTCTCCACTGTTGTCATCGAATTA
>probe:Drosophila_2:1629316_at:367:77; Interrogation_Position=1061; Antisense; AGGAGTCGGGAATTCCATCTTCGCA
>probe:Drosophila_2:1629316_at:205:39; Interrogation_Position=1109; Antisense; ATCTGTCCCTCTTGAAAGTGTCACT
>probe:Drosophila_2:1629316_at:3:577; Interrogation_Position=1193; Antisense; GGCCCGACTGGGAGATACCTGCTAT
>probe:Drosophila_2:1629316_at:158:93; Interrogation_Position=1205; Antisense; AGATACCTGCTATACACTTTTCCAA
>probe:Drosophila_2:1629316_at:652:389; Interrogation_Position=1305; Antisense; GAAACGGACACATTTCTTTTCGAAT
>probe:Drosophila_2:1629316_at:145:495; Interrogation_Position=738; Antisense; GTCATCTCCGAAAGAAAGGCGTCCT
>probe:Drosophila_2:1629316_at:209:169; Interrogation_Position=752; Antisense; AAAGGCGTCCTCAGAACCACAAGTG
>probe:Drosophila_2:1629316_at:432:521; Interrogation_Position=774; Antisense; GTGGCATCCAATACTACAACCGAAC
>probe:Drosophila_2:1629316_at:225:409; Interrogation_Position=814; Antisense; GACGAAAGCTTTTTGACGAGGCCGA
>probe:Drosophila_2:1629316_at:157:429; Interrogation_Position=837; Antisense; GAGTTCACCATCTGCAAGGGTCACA
>probe:Drosophila_2:1629316_at:225:195; Interrogation_Position=862; Antisense; AACTGAACCAGGACTTCCATCATAT
>probe:Drosophila_2:1629316_at:507:431; Interrogation_Position=920; Antisense; GAGTGCCAAGGATAACATTCCCTAT

Paste this into a BLAST search page for me
GTTTTGACGGTTAGCGTTCTCCACTGTTCTCCACTGTTGTCATCGAATTAAGGAGTCGGGAATTCCATCTTCGCAATCTGTCCCTCTTGAAAGTGTCACTGGCCCGACTGGGAGATACCTGCTATAGATACCTGCTATACACTTTTCCAAGAAACGGACACATTTCTTTTCGAATGTCATCTCCGAAAGAAAGGCGTCCTAAAGGCGTCCTCAGAACCACAAGTGGTGGCATCCAATACTACAACCGAACGACGAAAGCTTTTTGACGAGGCCGAGAGTTCACCATCTGCAAGGGTCACAAACTGAACCAGGACTTCCATCATATGAGTGCCAAGGATAACATTCCCTAT

Full Affymetrix probeset data:

Annotations for 1629316_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720