FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629317_at:

>probe:Drosophila_2:1629317_at:370:3; Interrogation_Position=136; Antisense; ATTGGCCCTGGCATTGTGGCACCTG
>probe:Drosophila_2:1629317_at:394:131; Interrogation_Position=175; Antisense; ACCGTTGTCGGATCTCCTCTGCTTG
>probe:Drosophila_2:1629317_at:113:281; Interrogation_Position=191; Antisense; CTCTGCTTGCTCCTCAGGTGGTGAG
>probe:Drosophila_2:1629317_at:305:535; Interrogation_Position=226; Antisense; GGTGCCATTTCTCATGCTGCCATCA
>probe:Drosophila_2:1629317_at:199:605; Interrogation_Position=275; Antisense; TGATCAAGAGCGTCCATGGCCTGGG
>probe:Drosophila_2:1629317_at:290:317; Interrogation_Position=293; Antisense; GCCTGGGACCAGTTGTGATCGGTTA
>probe:Drosophila_2:1629317_at:300:377; Interrogation_Position=309; Antisense; GATCGGTTAAACCAGTTACCCATTG
>probe:Drosophila_2:1629317_at:198:551; Interrogation_Position=333; Antisense; GGAGATCCAACCATCCATATAGCTC
>probe:Drosophila_2:1629317_at:485:239; Interrogation_Position=373; Antisense; AATCAGCGCTCCTGTTCAACCATAA
>probe:Drosophila_2:1629317_at:293:653; Interrogation_Position=388; Antisense; TCAACCATAACATTTCCTGCGGATT
>probe:Drosophila_2:1629317_at:689:629; Interrogation_Position=402; Antisense; TCCTGCGGATTACTTCAACCACAAG
>probe:Drosophila_2:1629317_at:122:257; Interrogation_Position=421; Antisense; CACAAGTTCTGTGCCCTGTTTATAA
>probe:Drosophila_2:1629317_at:351:167; Interrogation_Position=44; Antisense; AAATGTTCAAGCTGTGCGTCTTCGT
>probe:Drosophila_2:1629317_at:169:675; Interrogation_Position=527; Antisense; TACCATACATGTTATAGCGAGCGAA

Paste this into a BLAST search page for me
ATTGGCCCTGGCATTGTGGCACCTGACCGTTGTCGGATCTCCTCTGCTTGCTCTGCTTGCTCCTCAGGTGGTGAGGGTGCCATTTCTCATGCTGCCATCATGATCAAGAGCGTCCATGGCCTGGGGCCTGGGACCAGTTGTGATCGGTTAGATCGGTTAAACCAGTTACCCATTGGGAGATCCAACCATCCATATAGCTCAATCAGCGCTCCTGTTCAACCATAATCAACCATAACATTTCCTGCGGATTTCCTGCGGATTACTTCAACCACAAGCACAAGTTCTGTGCCCTGTTTATAAAAATGTTCAAGCTGTGCGTCTTCGTTACCATACATGTTATAGCGAGCGAA

Full Affymetrix probeset data:

Annotations for 1629317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720