Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629318_at:

>probe:Drosophila_2:1629318_at:146:343; Interrogation_Position=1190; Antisense; GCATTTAAACCCACCAGTGAGGCTG
>probe:Drosophila_2:1629318_at:499:425; Interrogation_Position=1217; Antisense; GAGACCACTGAAACAGCTCCAAGCA
>probe:Drosophila_2:1629318_at:163:425; Interrogation_Position=1259; Antisense; GAGACTGTTCTGATCACCACCAAGG
>probe:Drosophila_2:1629318_at:722:587; Interrogation_Position=1293; Antisense; TGGAGAACTTCCAGCCAGAGACCAC
>probe:Drosophila_2:1629318_at:703:423; Interrogation_Position=1310; Antisense; GAGACCACCACGAGTGCTTTGGACA
>probe:Drosophila_2:1629318_at:301:209; Interrogation_Position=1384; Antisense; AAGCAGCACTGAAGATCCAACTACA
>probe:Drosophila_2:1629318_at:14:145; Interrogation_Position=1418; Antisense; ACTGAGGCTCCAACTACGACGAGCA
>probe:Drosophila_2:1629318_at:494:417; Interrogation_Position=1544; Antisense; GAGCGAATCTTCAACTCCGACGGAG
>probe:Drosophila_2:1629318_at:654:547; Interrogation_Position=1570; Antisense; GGAGGTGCTCTACGGATACTCGTCT
>probe:Drosophila_2:1629318_at:24:457; Interrogation_Position=1584; Antisense; GATACTCGTCTGTGGTGCGGACCAA
>probe:Drosophila_2:1629318_at:621:201; Interrogation_Position=1607; Antisense; AACCGCTCGTGAGTGGTCAGCACCA
>probe:Drosophila_2:1629318_at:320:79; Interrogation_Position=1645; Antisense; AGGTCGGACAACTTGCCATTATGTG
>probe:Drosophila_2:1629318_at:35:443; Interrogation_Position=1676; Antisense; GATGCTCGGGTTGTTTTAGGCAATT
>probe:Drosophila_2:1629318_at:189:703; Interrogation_Position=1740; Antisense; TTATGCGACGATCCGCACAGTGTGA

Paste this into a BLAST search page for me
GCATTTAAACCCACCAGTGAGGCTGGAGACCACTGAAACAGCTCCAAGCAGAGACTGTTCTGATCACCACCAAGGTGGAGAACTTCCAGCCAGAGACCACGAGACCACCACGAGTGCTTTGGACAAAGCAGCACTGAAGATCCAACTACAACTGAGGCTCCAACTACGACGAGCAGAGCGAATCTTCAACTCCGACGGAGGGAGGTGCTCTACGGATACTCGTCTGATACTCGTCTGTGGTGCGGACCAAAACCGCTCGTGAGTGGTCAGCACCAAGGTCGGACAACTTGCCATTATGTGGATGCTCGGGTTGTTTTAGGCAATTTTATGCGACGATCCGCACAGTGTGA

Full Affymetrix probeset data:

Annotations for 1629318_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime