FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629319_at:

>probe:Drosophila_2:1629319_at:86:561; Interrogation_Position=1361; Antisense; GGAAAACAAAGCTTTCTCCCTGCTT
>probe:Drosophila_2:1629319_at:293:413; Interrogation_Position=1418; Antisense; GACCAACTGCGTTTTTTACCAATGC
>probe:Drosophila_2:1629319_at:109:523; Interrogation_Position=1477; Antisense; GGGCCTCTTTGCACGCGTGTGGAAC
>probe:Drosophila_2:1629319_at:312:155; Interrogation_Position=1506; Antisense; ACAGATATCGTTTTGCAGCAGTGCC
>probe:Drosophila_2:1629319_at:571:71; Interrogation_Position=1540; Antisense; AGGCACATTTTGTTTGCTGTCCTTG
>probe:Drosophila_2:1629319_at:215:645; Interrogation_Position=1592; Antisense; TCACATTTCGTACCCATTGAGCAAA
>probe:Drosophila_2:1629319_at:576:223; Interrogation_Position=1641; Antisense; AAGGACTACTTGTACATTGCCCACT
>probe:Drosophila_2:1629319_at:700:125; Interrogation_Position=1705; Antisense; AGCCAGAAACCACGCTTCAAGGACT
>probe:Drosophila_2:1629319_at:91:225; Interrogation_Position=1723; Antisense; AAGGACTCCACTGCATGTCCGTGGT
>probe:Drosophila_2:1629319_at:395:77; Interrogation_Position=1774; Antisense; AGGAGGCGGGCTACCAGGTCATTCT
>probe:Drosophila_2:1629319_at:420:57; Interrogation_Position=1789; Antisense; AGGTCATTCTCACACGCTTAAAGCC
>probe:Drosophila_2:1629319_at:623:173; Interrogation_Position=1808; Antisense; AAAGCCCGAACAGTGTACGCCAAAG
>probe:Drosophila_2:1629319_at:25:211; Interrogation_Position=1830; Antisense; AAGAATCACCTGCTAGTCGGACGTT
>probe:Drosophila_2:1629319_at:629:383; Interrogation_Position=1865; Antisense; GAACTGAACTTACAATCTGCCACTG

Paste this into a BLAST search page for me
GGAAAACAAAGCTTTCTCCCTGCTTGACCAACTGCGTTTTTTACCAATGCGGGCCTCTTTGCACGCGTGTGGAACACAGATATCGTTTTGCAGCAGTGCCAGGCACATTTTGTTTGCTGTCCTTGTCACATTTCGTACCCATTGAGCAAAAAGGACTACTTGTACATTGCCCACTAGCCAGAAACCACGCTTCAAGGACTAAGGACTCCACTGCATGTCCGTGGTAGGAGGCGGGCTACCAGGTCATTCTAGGTCATTCTCACACGCTTAAAGCCAAAGCCCGAACAGTGTACGCCAAAGAAGAATCACCTGCTAGTCGGACGTTGAACTGAACTTACAATCTGCCACTG

Full Affymetrix probeset data:

Annotations for 1629319_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720