FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629321_at:

>probe:Drosophila_2:1629321_at:625:73; Interrogation_Position=6510; Antisense; AGGACGCCCCATGGAATGCAACGAT
>probe:Drosophila_2:1629321_at:668:57; Interrogation_Position=6533; Antisense; ATGAGGATCATTGCTACATCTGCGA
>probe:Drosophila_2:1629321_at:122:153; Interrogation_Position=6548; Antisense; ACATCTGCGAGCTGCGTGTGGACAA
>probe:Drosophila_2:1629321_at:132:97; Interrogation_Position=6572; Antisense; AGACGGCAAGGTTCTTCTCAAAGGC
>probe:Drosophila_2:1629321_at:438:617; Interrogation_Position=6616; Antisense; TGCACCAAGAGCTATGCCTTCAGAA
>probe:Drosophila_2:1629321_at:206:117; Interrogation_Position=6670; Antisense; AGCTATGCGCCCCATGATGTGGATC
>probe:Drosophila_2:1629321_at:156:63; Interrogation_Position=6686; Antisense; ATGTGGATCCGTCGTTGCTGAAGAC
>probe:Drosophila_2:1629321_at:242:681; Interrogation_Position=6737; Antisense; TAGGAGCCGGGCCAACAACGATGCA
>probe:Drosophila_2:1629321_at:56:289; Interrogation_Position=6807; Antisense; GCGAAAGCCTCGTGGGATCAGTGCC
>probe:Drosophila_2:1629321_at:423:445; Interrogation_Position=6838; Antisense; GATGCAACTGCTGTCCATGTCGTAA
>probe:Drosophila_2:1629321_at:646:521; Interrogation_Position=6868; Antisense; GTGGCGCCCAATAAACAGATGCTTA
>probe:Drosophila_2:1629321_at:276:553; Interrogation_Position=6966; Antisense; GGAGCAACCCATTGACTTGTCATAC
>probe:Drosophila_2:1629321_at:304:213; Interrogation_Position=7021; Antisense; AAGACCCAGCAGTCCAGTAGCAGTT
>probe:Drosophila_2:1629321_at:447:89; Interrogation_Position=7036; Antisense; AGTAGCAGTTCTACGGCCAACTCAA

Paste this into a BLAST search page for me
AGGACGCCCCATGGAATGCAACGATATGAGGATCATTGCTACATCTGCGAACATCTGCGAGCTGCGTGTGGACAAAGACGGCAAGGTTCTTCTCAAAGGCTGCACCAAGAGCTATGCCTTCAGAAAGCTATGCGCCCCATGATGTGGATCATGTGGATCCGTCGTTGCTGAAGACTAGGAGCCGGGCCAACAACGATGCAGCGAAAGCCTCGTGGGATCAGTGCCGATGCAACTGCTGTCCATGTCGTAAGTGGCGCCCAATAAACAGATGCTTAGGAGCAACCCATTGACTTGTCATACAAGACCCAGCAGTCCAGTAGCAGTTAGTAGCAGTTCTACGGCCAACTCAA

Full Affymetrix probeset data:

Annotations for 1629321_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720