FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629322_at:

>probe:Drosophila_2:1629322_at:483:27; Interrogation_Position=4573; Antisense; ATACTTTTCGTACTGTGTTTGATTG
>probe:Drosophila_2:1629322_at:90:457; Interrogation_Position=4622; Antisense; GATACACAGCAGTCAATTTTTGAAC
>probe:Drosophila_2:1629322_at:469:689; Interrogation_Position=4680; Antisense; TTTGGCATATAATCGCACTCGGTTA
>probe:Drosophila_2:1629322_at:135:243; Interrogation_Position=4704; Antisense; AATATGAATAATCCGGTCCCACACT
>probe:Drosophila_2:1629322_at:551:257; Interrogation_Position=4723; Antisense; CACACTCTCCTAGTTGTTGCAATCA
>probe:Drosophila_2:1629322_at:524:513; Interrogation_Position=4764; Antisense; GTGTACGTGTACAAAGCAAACTACT
>probe:Drosophila_2:1629322_at:184:701; Interrogation_Position=4919; Antisense; TTTTATTGGTCTGCGTGTGCTAATC
>probe:Drosophila_2:1629322_at:86:689; Interrogation_Position=4986; Antisense; TATTTTTCTAGTTACTCTGCCGCTC
>probe:Drosophila_2:1629322_at:67:283; Interrogation_Position=5002; Antisense; CTGCCGCTCGCCTGAAAATCAAAAT
>probe:Drosophila_2:1629322_at:62:167; Interrogation_Position=5023; Antisense; AAATCCAGACAACTTTACGAGCCGA
>probe:Drosophila_2:1629322_at:713:671; Interrogation_Position=5038; Antisense; TACGAGCCGATCTAAACCCATTTCT
>probe:Drosophila_2:1629322_at:87:133; Interrogation_Position=5053; Antisense; ACCCATTTCTGGATTTAGTTGTGAC
>probe:Drosophila_2:1629322_at:83:687; Interrogation_Position=5096; Antisense; TATTTCTTGGTCATTTCGTTGCTTG
>probe:Drosophila_2:1629322_at:180:637; Interrogation_Position=5111; Antisense; TCGTTGCTTGTTTTTGTTCCTTAGA

Paste this into a BLAST search page for me
ATACTTTTCGTACTGTGTTTGATTGGATACACAGCAGTCAATTTTTGAACTTTGGCATATAATCGCACTCGGTTAAATATGAATAATCCGGTCCCACACTCACACTCTCCTAGTTGTTGCAATCAGTGTACGTGTACAAAGCAAACTACTTTTTATTGGTCTGCGTGTGCTAATCTATTTTTCTAGTTACTCTGCCGCTCCTGCCGCTCGCCTGAAAATCAAAATAAATCCAGACAACTTTACGAGCCGATACGAGCCGATCTAAACCCATTTCTACCCATTTCTGGATTTAGTTGTGACTATTTCTTGGTCATTTCGTTGCTTGTCGTTGCTTGTTTTTGTTCCTTAGA

Full Affymetrix probeset data:

Annotations for 1629322_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720