Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629323_at:

>probe:Drosophila_2:1629323_at:605:431; Interrogation_Position=1279; Antisense; GAGTCTACTACAACCACAGAACGTG
>probe:Drosophila_2:1629323_at:188:33; Interrogation_Position=1362; Antisense; ATCAACGGACCCATCAACAACAAGT
>probe:Drosophila_2:1629323_at:261:715; Interrogation_Position=1386; Antisense; TTCTACAACCGAACCTTCAACGACA
>probe:Drosophila_2:1629323_at:371:397; Interrogation_Position=1407; Antisense; GACAACCAACAGAAGTTCCTCATCT
>probe:Drosophila_2:1629323_at:564:469; Interrogation_Position=1421; Antisense; GTTCCTCATCTACAACAACAACGAC
>probe:Drosophila_2:1629323_at:217:187; Interrogation_Position=1452; Antisense; AACAGAACCTTCAACGACCACGACG
>probe:Drosophila_2:1629323_at:538:259; Interrogation_Position=1470; Antisense; CACGACGGTTTCTTCCACAACAACT
>probe:Drosophila_2:1629323_at:349:185; Interrogation_Position=1512; Antisense; AACAGAATCTTCTACGACAACTACG
>probe:Drosophila_2:1629323_at:156:147; Interrogation_Position=1549; Antisense; ACTCTTGCCGAATCGTCTACAGTAA
>probe:Drosophila_2:1629323_at:470:95; Interrogation_Position=1629; Antisense; AGATTCTTCCACAACCACATTAACT
>probe:Drosophila_2:1629323_at:423:151; Interrogation_Position=1645; Antisense; ACATTAACTACAGATGCCCCATCAA
>probe:Drosophila_2:1629323_at:536:447; Interrogation_Position=1657; Antisense; GATGCCCCATCAACGACAACATTAT
>probe:Drosophila_2:1629323_at:611:37; Interrogation_Position=1692; Antisense; ATCTACAACAATTAACCCGGCTGCT
>probe:Drosophila_2:1629323_at:525:131; Interrogation_Position=1706; Antisense; ACCCGGCTGCTGTAAGTACCATATT

Paste this into a BLAST search page for me
GAGTCTACTACAACCACAGAACGTGATCAACGGACCCATCAACAACAAGTTTCTACAACCGAACCTTCAACGACAGACAACCAACAGAAGTTCCTCATCTGTTCCTCATCTACAACAACAACGACAACAGAACCTTCAACGACCACGACGCACGACGGTTTCTTCCACAACAACTAACAGAATCTTCTACGACAACTACGACTCTTGCCGAATCGTCTACAGTAAAGATTCTTCCACAACCACATTAACTACATTAACTACAGATGCCCCATCAAGATGCCCCATCAACGACAACATTATATCTACAACAATTAACCCGGCTGCTACCCGGCTGCTGTAAGTACCATATT

Full Affymetrix probeset data:

Annotations for 1629323_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime