FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629324_at:

>probe:Drosophila_2:1629324_at:507:33; Interrogation_Position=270; Antisense; ATCAGGTGGTCGTTGTACCAAGCAA
>probe:Drosophila_2:1629324_at:381:341; Interrogation_Position=360; Antisense; GCTTCGACGATTGCTGGGTGGTAAT
>probe:Drosophila_2:1629324_at:324:679; Interrogation_Position=391; Antisense; TAGGGTCTACGATGTGACACACTTT
>probe:Drosophila_2:1629324_at:271:159; Interrogation_Position=407; Antisense; ACACACTTTCTAAGGGATCATCCCG
>probe:Drosophila_2:1629324_at:703:409; Interrogation_Position=437; Antisense; GACGACGTCATTATGGATCACGCAG
>probe:Drosophila_2:1629324_at:311:543; Interrogation_Position=526; Antisense; GGATTTCTTGATCGGTCAACTGCCC
>probe:Drosophila_2:1629324_at:245:263; Interrogation_Position=557; Antisense; CAGCACATTTTTCGCACTGGCAAAA
>probe:Drosophila_2:1629324_at:128:715; Interrogation_Position=590; Antisense; TTGTCCCTGGGCATACCGGAATAAT
>probe:Drosophila_2:1629324_at:311:33; Interrogation_Position=615; Antisense; ATAATGCCAGCCGATTTTGCACCGA
>probe:Drosophila_2:1629324_at:72:293; Interrogation_Position=653; Antisense; CGTCCTCCATGTCGTATATGTCTAT
>probe:Drosophila_2:1629324_at:704:429; Interrogation_Position=695; Antisense; GAGTATTCATCGACTAGTTTTCTAG
>probe:Drosophila_2:1629324_at:445:477; Interrogation_Position=711; Antisense; GTTTTCTAGTTGTAATCCGCTTATT
>probe:Drosophila_2:1629324_at:216:343; Interrogation_Position=729; Antisense; GCTTATTTCGAATTCCGCTAAACGG
>probe:Drosophila_2:1629324_at:271:339; Interrogation_Position=745; Antisense; GCTAAACGGCTTTTGCTTAATCATC

Paste this into a BLAST search page for me
ATCAGGTGGTCGTTGTACCAAGCAAGCTTCGACGATTGCTGGGTGGTAATTAGGGTCTACGATGTGACACACTTTACACACTTTCTAAGGGATCATCCCGGACGACGTCATTATGGATCACGCAGGGATTTCTTGATCGGTCAACTGCCCCAGCACATTTTTCGCACTGGCAAAATTGTCCCTGGGCATACCGGAATAATATAATGCCAGCCGATTTTGCACCGACGTCCTCCATGTCGTATATGTCTATGAGTATTCATCGACTAGTTTTCTAGGTTTTCTAGTTGTAATCCGCTTATTGCTTATTTCGAATTCCGCTAAACGGGCTAAACGGCTTTTGCTTAATCATC

Full Affymetrix probeset data:

Annotations for 1629324_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720