FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629327_at:

>probe:Drosophila_2:1629327_at:154:435; Interrogation_Position=104; Antisense; GAGGTGCTGCAGCATGCCTTGCATA
>probe:Drosophila_2:1629327_at:698:345; Interrogation_Position=115; Antisense; GCATGCCTTGCATATTTAATCCGGG
>probe:Drosophila_2:1629327_at:553:653; Interrogation_Position=131; Antisense; TAATCCGGGCTACATTGGACCCGAT
>probe:Drosophila_2:1629327_at:287:355; Interrogation_Position=14; Antisense; GCACCCAGTTAGCATCTATGTAAAT
>probe:Drosophila_2:1629327_at:315:333; Interrogation_Position=163; Antisense; GCTGTGACCCCGATTGCTTGGAGGA
>probe:Drosophila_2:1629327_at:221:5; Interrogation_Position=175; Antisense; ATTGCTTGGAGGAGGGCCACTGCAC
>probe:Drosophila_2:1629327_at:78:83; Interrogation_Position=208; Antisense; AGTGCGGAGTTTGCCCGGAGTCCCA
>probe:Drosophila_2:1629327_at:357:235; Interrogation_Position=259; Antisense; AATCCAACAAGGACGCGGCGAAGCA
>probe:Drosophila_2:1629327_at:729:575; Interrogation_Position=275; Antisense; GGCGAAGCAACCACTGGACCAGAAA
>probe:Drosophila_2:1629327_at:613:107; Interrogation_Position=308; Antisense; AGAACCGAAGCTCCGGGAACAGAAG
>probe:Drosophila_2:1629327_at:276:617; Interrogation_Position=354; Antisense; TGCAAAAATGAACCAGGAGTCCTTT
>probe:Drosophila_2:1629327_at:425:87; Interrogation_Position=371; Antisense; AGTCCTTTGGAGATGTGCTGAACAC
>probe:Drosophila_2:1629327_at:324:169; Interrogation_Position=52; Antisense; AAAGTGGGACCCAATTTGCCACTGC
>probe:Drosophila_2:1629327_at:568:311; Interrogation_Position=82; Antisense; GCCTCGACCTTCGTTTTCAGTGGAG

Paste this into a BLAST search page for me
GAGGTGCTGCAGCATGCCTTGCATAGCATGCCTTGCATATTTAATCCGGGTAATCCGGGCTACATTGGACCCGATGCACCCAGTTAGCATCTATGTAAATGCTGTGACCCCGATTGCTTGGAGGAATTGCTTGGAGGAGGGCCACTGCACAGTGCGGAGTTTGCCCGGAGTCCCAAATCCAACAAGGACGCGGCGAAGCAGGCGAAGCAACCACTGGACCAGAAAAGAACCGAAGCTCCGGGAACAGAAGTGCAAAAATGAACCAGGAGTCCTTTAGTCCTTTGGAGATGTGCTGAACACAAAGTGGGACCCAATTTGCCACTGCGCCTCGACCTTCGTTTTCAGTGGAG

Full Affymetrix probeset data:

Annotations for 1629327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720