FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629332_at:

>probe:Drosophila_2:1629332_at:142:551; Interrogation_Position=1035; Antisense; GGAGCTACTCTTGGCCAAGCTAAGT
>probe:Drosophila_2:1629332_at:354:565; Interrogation_Position=1073; Antisense; GGAATCATTTCCTAATGCTCGATCT
>probe:Drosophila_2:1629332_at:324:243; Interrogation_Position=1105; Antisense; AATATCGCCTCTATATTGCGACAGA
>probe:Drosophila_2:1629332_at:546:121; Interrogation_Position=1172; Antisense; AGCGGAAGATTCGTTTGTGCCAGGA
>probe:Drosophila_2:1629332_at:258:205; Interrogation_Position=1213; Antisense; AAGGTCGTAACTCCTGGAATCTCCA
>probe:Drosophila_2:1629332_at:1:5; Interrogation_Position=1239; Antisense; ATTGAAGGCTATCGCCCTCTATGAA
>probe:Drosophila_2:1629332_at:446:383; Interrogation_Position=1261; Antisense; GAACTGGCTAACACACAGGCCGAAT
>probe:Drosophila_2:1629332_at:255:251; Interrogation_Position=1323; Antisense; CAATGACCTCCTGGCGGAATTGGAA
>probe:Drosophila_2:1629332_at:74:331; Interrogation_Position=1365; Antisense; GCGGGAGTCTCTGCGAATGCTTCTA
>probe:Drosophila_2:1629332_at:29:53; Interrogation_Position=1381; Antisense; ATGCTTCTATTTGAGCCACTGGCCA
>probe:Drosophila_2:1629332_at:371:101; Interrogation_Position=1410; Antisense; AGAGGGCCAGCTGACGCGATCAATG
>probe:Drosophila_2:1629332_at:493:61; Interrogation_Position=924; Antisense; ATGGCAGTGCCTTCTTAATCCGGAG
>probe:Drosophila_2:1629332_at:536:233; Interrogation_Position=940; Antisense; AATCCGGAGCACACACTGAAACAGG
>probe:Drosophila_2:1629332_at:545:549; Interrogation_Position=963; Antisense; GGAGTTTGTCTCGAATATGCTGGAA

Paste this into a BLAST search page for me
GGAGCTACTCTTGGCCAAGCTAAGTGGAATCATTTCCTAATGCTCGATCTAATATCGCCTCTATATTGCGACAGAAGCGGAAGATTCGTTTGTGCCAGGAAAGGTCGTAACTCCTGGAATCTCCAATTGAAGGCTATCGCCCTCTATGAAGAACTGGCTAACACACAGGCCGAATCAATGACCTCCTGGCGGAATTGGAAGCGGGAGTCTCTGCGAATGCTTCTAATGCTTCTATTTGAGCCACTGGCCAAGAGGGCCAGCTGACGCGATCAATGATGGCAGTGCCTTCTTAATCCGGAGAATCCGGAGCACACACTGAAACAGGGGAGTTTGTCTCGAATATGCTGGAA

Full Affymetrix probeset data:

Annotations for 1629332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720