FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629337_at:

>probe:Drosophila_2:1629337_at:227:485; Interrogation_Position=1614; Antisense; GTATGTGCACAATAAGCTGCCCGCC
>probe:Drosophila_2:1629337_at:87:291; Interrogation_Position=1638; Antisense; CGGTCGTTTGGCCACATTGATGAAG
>probe:Drosophila_2:1629337_at:171:613; Interrogation_Position=1761; Antisense; TGAAGCGCCGCCCATGGAGTTTGAT
>probe:Drosophila_2:1629337_at:206:67; Interrogation_Position=1774; Antisense; ATGGAGTTTGATTCGCCGCTAAAGA
>probe:Drosophila_2:1629337_at:678:663; Interrogation_Position=1793; Antisense; TAAAGAGTGTGCCAACGCCAGGACC
>probe:Drosophila_2:1629337_at:287:27; Interrogation_Position=1833; Antisense; ATAGCTAGAGGCACCGGCAGTCGCA
>probe:Drosophila_2:1629337_at:106:307; Interrogation_Position=1861; Antisense; CCTGCGGCTGTCGTCGGATGATGAT
>probe:Drosophila_2:1629337_at:61:441; Interrogation_Position=1928; Antisense; GAGGCCATGTATGTGGCTACCTCAT
>probe:Drosophila_2:1629337_at:409:571; Interrogation_Position=1942; Antisense; GGCTACCTCATATACTTCTCTGGAG
>probe:Drosophila_2:1629337_at:455:641; Interrogation_Position=1960; Antisense; TCTGGAGCAGCCGACCGGATGGCAA
>probe:Drosophila_2:1629337_at:94:585; Interrogation_Position=1979; Antisense; TGGCAATCCCCAATTAGCATGCTTG
>probe:Drosophila_2:1629337_at:585:663; Interrogation_Position=2037; Antisense; TAAAGCACTGCGACCGAGCAATCGG
>probe:Drosophila_2:1629337_at:485:485; Interrogation_Position=2086; Antisense; GTATGGCTTTGTTGGCAGGCATCAA
>probe:Drosophila_2:1629337_at:613:345; Interrogation_Position=2104; Antisense; GCATCAATCAGTTGTCGCTGGCTAT

Paste this into a BLAST search page for me
GTATGTGCACAATAAGCTGCCCGCCCGGTCGTTTGGCCACATTGATGAAGTGAAGCGCCGCCCATGGAGTTTGATATGGAGTTTGATTCGCCGCTAAAGATAAAGAGTGTGCCAACGCCAGGACCATAGCTAGAGGCACCGGCAGTCGCACCTGCGGCTGTCGTCGGATGATGATGAGGCCATGTATGTGGCTACCTCATGGCTACCTCATATACTTCTCTGGAGTCTGGAGCAGCCGACCGGATGGCAATGGCAATCCCCAATTAGCATGCTTGTAAAGCACTGCGACCGAGCAATCGGGTATGGCTTTGTTGGCAGGCATCAAGCATCAATCAGTTGTCGCTGGCTAT

Full Affymetrix probeset data:

Annotations for 1629337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720