Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629340_s_at:

>probe:Drosophila_2:1629340_s_at:246:633; Interrogation_Position=100; Antisense; TCCGATGTCAATGCCGATAGCTATA
>probe:Drosophila_2:1629340_s_at:365:61; Interrogation_Position=104; Antisense; ATGTCAATGCCGATAGCTATAGCTA
>probe:Drosophila_2:1629340_s_at:55:495; Interrogation_Position=106; Antisense; GTCAATGCCGATAGCTATAGCTACA
>probe:Drosophila_2:1629340_s_at:638:159; Interrogation_Position=139; Antisense; ACAAGCGATGGCACCAAGCAGGAGC
>probe:Drosophila_2:1629340_s_at:560:375; Interrogation_Position=177; Antisense; GAAGAGCCTTGGTCCCGAGGAGGAT
>probe:Drosophila_2:1629340_s_at:544:47; Interrogation_Position=200; Antisense; ATGCCTTGCAGGTGGCCGGATCCTT
>probe:Drosophila_2:1629340_s_at:532:557; Interrogation_Position=244; Antisense; GGACAGACGCATGCCATCAGCTACG
>probe:Drosophila_2:1629340_s_at:385:103; Interrogation_Position=248; Antisense; AGACGCATGCCATCAGCTACGTGGC
>probe:Drosophila_2:1629340_s_at:7:627; Interrogation_Position=66; Antisense; TGCCGCTCCGGATGCAGAGATTGTT
>probe:Drosophila_2:1629340_s_at:587:281; Interrogation_Position=71; Antisense; CTCCGGATGCAGAGATTGTTGACCT
>probe:Drosophila_2:1629340_s_at:348:101; Interrogation_Position=81; Antisense; AGAGATTGTTGACCTGGTGTCCGAT
>probe:Drosophila_2:1629340_s_at:641:5; Interrogation_Position=85; Antisense; ATTGTTGACCTGGTGTCCGATGTCA
>probe:Drosophila_2:1629340_s_at:319:603; Interrogation_Position=87; Antisense; TGTTGACCTGGTGTCCGATGTCAAT
>probe:Drosophila_2:1629340_s_at:581:597; Interrogation_Position=98; Antisense; TGTCCGATGTCAATGCCGATAGCTA

Paste this into a BLAST search page for me
TCCGATGTCAATGCCGATAGCTATAATGTCAATGCCGATAGCTATAGCTAGTCAATGCCGATAGCTATAGCTACAACAAGCGATGGCACCAAGCAGGAGCGAAGAGCCTTGGTCCCGAGGAGGATATGCCTTGCAGGTGGCCGGATCCTTGGACAGACGCATGCCATCAGCTACGAGACGCATGCCATCAGCTACGTGGCTGCCGCTCCGGATGCAGAGATTGTTCTCCGGATGCAGAGATTGTTGACCTAGAGATTGTTGACCTGGTGTCCGATATTGTTGACCTGGTGTCCGATGTCATGTTGACCTGGTGTCCGATGTCAATTGTCCGATGTCAATGCCGATAGCTA

Full Affymetrix probeset data:

Annotations for 1629340_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime