Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629343_at:

>probe:Drosophila_2:1629343_at:249:305; Interrogation_Position=5824; Antisense; CCGGACCAGGTCAGAACGTGTACGT
>probe:Drosophila_2:1629343_at:517:569; Interrogation_Position=5886; Antisense; GGCATGTTCTACCAGTGCAGCGAAA
>probe:Drosophila_2:1629343_at:717:189; Interrogation_Position=5931; Antisense; AACATCGTGGTATTCCAATGCCCCA
>probe:Drosophila_2:1629343_at:567:265; Interrogation_Position=6004; Antisense; CAGGTGACAAGTGCTCCAAGGACAT
>probe:Drosophila_2:1629343_at:610:369; Interrogation_Position=6029; Antisense; GAAGAGGACCACCAACGCGTTTGAA
>probe:Drosophila_2:1629343_at:437:165; Interrogation_Position=6082; Antisense; AAATCAGCACGACAGATCCGCTCTG
>probe:Drosophila_2:1629343_at:677:57; Interrogation_Position=6112; Antisense; ATGAGGGTCACTTCGCGCTCAACAA
>probe:Drosophila_2:1629343_at:449:579; Interrogation_Position=6147; Antisense; GGCCAGCTGTTCGTCAAGTGCGGAT
>probe:Drosophila_2:1629343_at:495:653; Interrogation_Position=6160; Antisense; TCAAGTGCGGATTCTCGGAGCTGAC
>probe:Drosophila_2:1629343_at:222:611; Interrogation_Position=6181; Antisense; TGACGGGTCGCATCGAAGGCCAGAT
>probe:Drosophila_2:1629343_at:503:529; Interrogation_Position=6221; Antisense; GGGATTCGCCTACTGGAACGTTAGC
>probe:Drosophila_2:1629343_at:327:383; Interrogation_Position=6236; Antisense; GAACGTTAGCCGACGATGCGAGCCC
>probe:Drosophila_2:1629343_at:54:391; Interrogation_Position=6307; Antisense; GAAACGTGCCGCTGGAGTGGCTCAA
>probe:Drosophila_2:1629343_at:289:677; Interrogation_Position=6341; Antisense; TAGACGCCGCAGCATGCGCATTTAA

Paste this into a BLAST search page for me
CCGGACCAGGTCAGAACGTGTACGTGGCATGTTCTACCAGTGCAGCGAAAAACATCGTGGTATTCCAATGCCCCACAGGTGACAAGTGCTCCAAGGACATGAAGAGGACCACCAACGCGTTTGAAAAATCAGCACGACAGATCCGCTCTGATGAGGGTCACTTCGCGCTCAACAAGGCCAGCTGTTCGTCAAGTGCGGATTCAAGTGCGGATTCTCGGAGCTGACTGACGGGTCGCATCGAAGGCCAGATGGGATTCGCCTACTGGAACGTTAGCGAACGTTAGCCGACGATGCGAGCCCGAAACGTGCCGCTGGAGTGGCTCAATAGACGCCGCAGCATGCGCATTTAA

Full Affymetrix probeset data:

Annotations for 1629343_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime