FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629344_at:

>probe:Drosophila_2:1629344_at:98:647; Interrogation_Position=1017; Antisense; TCATCTTCATCTCTCAGGAATCACG
>probe:Drosophila_2:1629344_at:672:365; Interrogation_Position=1034; Antisense; GAATCACGAGTGCACGCATACGGCC
>probe:Drosophila_2:1629344_at:331:29; Interrogation_Position=1051; Antisense; ATACGGCCATGCCATTTGAGTGCGC
>probe:Drosophila_2:1629344_at:226:187; Interrogation_Position=1104; Antisense; AACAAACTACGCATGCACCTGGAGC
>probe:Drosophila_2:1629344_at:214:619; Interrogation_Position=1171; Antisense; TGCGAAAGTTTCACATCGTGCGCTC
>probe:Drosophila_2:1629344_at:492:151; Interrogation_Position=1183; Antisense; ACATCGTGCGCTCCAAGTTGGTAAT
>probe:Drosophila_2:1629344_at:360:567; Interrogation_Position=1208; Antisense; GGCAAAGATTTACTCGGACCAGAAA
>probe:Drosophila_2:1629344_at:618:189; Interrogation_Position=1329; Antisense; AACTCGCATCCCATTTTAAATTCCG
>probe:Drosophila_2:1629344_at:443:271; Interrogation_Position=1398; Antisense; CATTTGGTTATCTTACACGGACAGG
>probe:Drosophila_2:1629344_at:550:595; Interrogation_Position=909; Antisense; TGTGATCGTCGTTTCGCACAGCGAT
>probe:Drosophila_2:1629344_at:372:19; Interrogation_Position=937; Antisense; ATTTGACTGTCCACCAGCAGGTTAA
>probe:Drosophila_2:1629344_at:373:77; Interrogation_Position=955; Antisense; AGGTTAAGCACTCTGGATCTCGCTT
>probe:Drosophila_2:1629344_at:518:19; Interrogation_Position=981; Antisense; ATTTGCGAGTTTCCCGGCTGCCAGA
>probe:Drosophila_2:1629344_at:591:625; Interrogation_Position=999; Antisense; TGCCAGAAGTCCTTTACCTCATCTT

Paste this into a BLAST search page for me
TCATCTTCATCTCTCAGGAATCACGGAATCACGAGTGCACGCATACGGCCATACGGCCATGCCATTTGAGTGCGCAACAAACTACGCATGCACCTGGAGCTGCGAAAGTTTCACATCGTGCGCTCACATCGTGCGCTCCAAGTTGGTAATGGCAAAGATTTACTCGGACCAGAAAAACTCGCATCCCATTTTAAATTCCGCATTTGGTTATCTTACACGGACAGGTGTGATCGTCGTTTCGCACAGCGATATTTGACTGTCCACCAGCAGGTTAAAGGTTAAGCACTCTGGATCTCGCTTATTTGCGAGTTTCCCGGCTGCCAGATGCCAGAAGTCCTTTACCTCATCTT

Full Affymetrix probeset data:

Annotations for 1629344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720