FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629345_at:

>probe:Drosophila_2:1629345_at:392:129; Interrogation_Position=1004; Antisense; ACCGTTTTCCCAGCAGTCGTACAAG
>probe:Drosophila_2:1629345_at:215:121; Interrogation_Position=1027; Antisense; AGCTGGCCCGCAAAGATAACATCAT
>probe:Drosophila_2:1629345_at:222:45; Interrogation_Position=1052; Antisense; ATCGCCGCAGAAGGATGTGCCGCAA
>probe:Drosophila_2:1629345_at:233:173; Interrogation_Position=1076; Antisense; AAAGAGCTCCGGTCTGATGGACAAG
>probe:Drosophila_2:1629345_at:120:315; Interrogation_Position=1101; Antisense; GCCATGGACCTGATATTCGGCTGGT
>probe:Drosophila_2:1629345_at:639:585; Interrogation_Position=1170; Antisense; TGGAGTTTCCGGCTACTTATTTAAT
>probe:Drosophila_2:1629345_at:154:33; Interrogation_Position=1193; Antisense; ATAATTCACTGCCTACATCCAGCAT
>probe:Drosophila_2:1629345_at:394:315; Interrogation_Position=691; Antisense; GCCTATCCGACTTTTGGGTTACCAT
>probe:Drosophila_2:1629345_at:707:3; Interrogation_Position=777; Antisense; ATTGTGGACGTGGTGCATGCCCCGC
>probe:Drosophila_2:1629345_at:357:195; Interrogation_Position=810; Antisense; AACTGGATGTATGTGCGCTACTCCT
>probe:Drosophila_2:1629345_at:649:323; Interrogation_Position=847; Antisense; GCGACAAGGCGCTGAACTACAACGA
>probe:Drosophila_2:1629345_at:334:239; Interrogation_Position=875; Antisense; AATCATCGCCGGCAATGTGATGGTG
>probe:Drosophila_2:1629345_at:418:657; Interrogation_Position=935; Antisense; TAAGGAGAACATCGGCTCTGTGCCC
>probe:Drosophila_2:1629345_at:13:125; Interrogation_Position=987; Antisense; AGCCCCAGTGCGATTCGACCGTTTT

Paste this into a BLAST search page for me
ACCGTTTTCCCAGCAGTCGTACAAGAGCTGGCCCGCAAAGATAACATCATATCGCCGCAGAAGGATGTGCCGCAAAAAGAGCTCCGGTCTGATGGACAAGGCCATGGACCTGATATTCGGCTGGTTGGAGTTTCCGGCTACTTATTTAATATAATTCACTGCCTACATCCAGCATGCCTATCCGACTTTTGGGTTACCATATTGTGGACGTGGTGCATGCCCCGCAACTGGATGTATGTGCGCTACTCCTGCGACAAGGCGCTGAACTACAACGAAATCATCGCCGGCAATGTGATGGTGTAAGGAGAACATCGGCTCTGTGCCCAGCCCCAGTGCGATTCGACCGTTTT

Full Affymetrix probeset data:

Annotations for 1629345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720