Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629346_at:

>probe:Drosophila_2:1629346_at:614:443; Interrogation_Position=1745; Antisense; GATGATCGGGATAAGCGGCTCTTCG
>probe:Drosophila_2:1629346_at:144:459; Interrogation_Position=1775; Antisense; GATATGCGCGATCTGGACTGGACCA
>probe:Drosophila_2:1629346_at:583:87; Interrogation_Position=1814; Antisense; AGTCTCTACGGACTGCGTCTGTATG
>probe:Drosophila_2:1629346_at:672:223; Interrogation_Position=1844; Antisense; AAGGATGATCCCAGCAACATTCCCG
>probe:Drosophila_2:1629346_at:240:295; Interrogation_Position=1867; Antisense; CGAGTCCATCAAGCGCTACGAGAGA
>probe:Drosophila_2:1629346_at:92:373; Interrogation_Position=1894; Antisense; GAAGGTCCTGCACTATACGACACTG
>probe:Drosophila_2:1629346_at:486:155; Interrogation_Position=1913; Antisense; ACACTGGCTGTTTTCTACGCGTTAG
>probe:Drosophila_2:1629346_at:116:51; Interrogation_Position=1953; Antisense; ATGCCCTGCTCAAGCTATTCTTATA
>probe:Drosophila_2:1629346_at:476:645; Interrogation_Position=1998; Antisense; TCTTTCGTATCCATTGTAGGGCATA
>probe:Drosophila_2:1629346_at:228:237; Interrogation_Position=2036; Antisense; AATCTTTCGGTCAAGCTCGTAACAC
>probe:Drosophila_2:1629346_at:512:279; Interrogation_Position=2051; Antisense; CTCGTAACACTTTCGTTTCCAGTAG
>probe:Drosophila_2:1629346_at:267:481; Interrogation_Position=2117; Antisense; GTTTGTACCATAACCATATGCCCAT
>probe:Drosophila_2:1629346_at:15:391; Interrogation_Position=2154; Antisense; GAAACGCTTTATCCGAATCTTGTAT
>probe:Drosophila_2:1629346_at:245:481; Interrogation_Position=2175; Antisense; GTATAGCTTAGTTCGTACGTCTCTA

Paste this into a BLAST search page for me
GATGATCGGGATAAGCGGCTCTTCGGATATGCGCGATCTGGACTGGACCAAGTCTCTACGGACTGCGTCTGTATGAAGGATGATCCCAGCAACATTCCCGCGAGTCCATCAAGCGCTACGAGAGAGAAGGTCCTGCACTATACGACACTGACACTGGCTGTTTTCTACGCGTTAGATGCCCTGCTCAAGCTATTCTTATATCTTTCGTATCCATTGTAGGGCATAAATCTTTCGGTCAAGCTCGTAACACCTCGTAACACTTTCGTTTCCAGTAGGTTTGTACCATAACCATATGCCCATGAAACGCTTTATCCGAATCTTGTATGTATAGCTTAGTTCGTACGTCTCTA

Full Affymetrix probeset data:

Annotations for 1629346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime