Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629347_at:

>probe:Drosophila_2:1629347_at:208:487; Interrogation_Position=3286; Antisense; GTACCGGAAATCTCTGCGAAGACTG
>probe:Drosophila_2:1629347_at:8:101; Interrogation_Position=3384; Antisense; AGAGGGCAGCACTCATATGACCACC
>probe:Drosophila_2:1629347_at:504:679; Interrogation_Position=3399; Antisense; TATGACCACCCAACGTATTAGAAGT
>probe:Drosophila_2:1629347_at:727:723; Interrogation_Position=3438; Antisense; TTGCTAGATCCTTTCGCGCGTCAAA
>probe:Drosophila_2:1629347_at:112:457; Interrogation_Position=3481; Antisense; GATAGCCAGGATCTTCGATACAGCT
>probe:Drosophila_2:1629347_at:85:665; Interrogation_Position=3499; Antisense; TACAGCTAGCAATTCCATGTTCCAC
>probe:Drosophila_2:1629347_at:472:57; Interrogation_Position=3515; Antisense; ATGTTCCACACCTAGGCTATACTAC
>probe:Drosophila_2:1629347_at:145:21; Interrogation_Position=3565; Antisense; ATATGGGTCAGATCCATCGTCCCGA
>probe:Drosophila_2:1629347_at:669:443; Interrogation_Position=3588; Antisense; GATGATCTGATCTCTCAGCATTTTG
>probe:Drosophila_2:1629347_at:658:91; Interrogation_Position=3632; Antisense; AGTTAGACTCGCTACTTAGGCTTCA
>probe:Drosophila_2:1629347_at:18:705; Interrogation_Position=3647; Antisense; TTAGGCTTCATAGGCACGCCGCATT
>probe:Drosophila_2:1629347_at:702:225; Interrogation_Position=3676; Antisense; AAGGCATTACTTTTGTACTCCTAAT
>probe:Drosophila_2:1629347_at:169:657; Interrogation_Position=3814; Antisense; TAAGGGATGCCTGCCTACACAAGAA
>probe:Drosophila_2:1629347_at:528:393; Interrogation_Position=3850; Antisense; GACAAAGAATTCTCCCTAGGGCTCA

Paste this into a BLAST search page for me
GTACCGGAAATCTCTGCGAAGACTGAGAGGGCAGCACTCATATGACCACCTATGACCACCCAACGTATTAGAAGTTTGCTAGATCCTTTCGCGCGTCAAAGATAGCCAGGATCTTCGATACAGCTTACAGCTAGCAATTCCATGTTCCACATGTTCCACACCTAGGCTATACTACATATGGGTCAGATCCATCGTCCCGAGATGATCTGATCTCTCAGCATTTTGAGTTAGACTCGCTACTTAGGCTTCATTAGGCTTCATAGGCACGCCGCATTAAGGCATTACTTTTGTACTCCTAATTAAGGGATGCCTGCCTACACAAGAAGACAAAGAATTCTCCCTAGGGCTCA

Full Affymetrix probeset data:

Annotations for 1629347_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime