FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629348_at:

>probe:Drosophila_2:1629348_at:318:411; Interrogation_Position=180; Antisense; GACCTGCAAGGATTTACCGCCTAAT
>probe:Drosophila_2:1629348_at:468:581; Interrogation_Position=205; Antisense; TGGTTCGTTTTACAACGTGGTCAAG
>probe:Drosophila_2:1629348_at:564:705; Interrogation_Position=214; Antisense; TTACAACGTGGTCAAGATGGGTCTT
>probe:Drosophila_2:1629348_at:326:215; Interrogation_Position=227; Antisense; AAGATGGGTCTTGTGGCACTTGGAC
>probe:Drosophila_2:1629348_at:341:149; Interrogation_Position=244; Antisense; ACTTGGACGCCTTTCGACGATCGTT
>probe:Drosophila_2:1629348_at:130:717; Interrogation_Position=256; Antisense; TTCGACGATCGTTTCGCGGCCTAAA
>probe:Drosophila_2:1629348_at:37:695; Interrogation_Position=267; Antisense; TTTCGCGGCCTAAATCAGCACGTAT
>probe:Drosophila_2:1629348_at:333:165; Interrogation_Position=278; Antisense; AAATCAGCACGTATGCGGTGGCCAA
>probe:Drosophila_2:1629348_at:671:483; Interrogation_Position=288; Antisense; GTATGCGGTGGCCAAGACTGTATCT
>probe:Drosophila_2:1629348_at:137:213; Interrogation_Position=301; Antisense; AAGACTGTATCTTTTGCGCTCTAAA
>probe:Drosophila_2:1629348_at:83:385; Interrogation_Position=339; Antisense; GAACTCTGGCTTTAAAATCATTTGG
>probe:Drosophila_2:1629348_at:712:163; Interrogation_Position=353; Antisense; AAATCATTTGGTATCGGCATTCGAA
>probe:Drosophila_2:1629348_at:596:39; Interrogation_Position=365; Antisense; ATCGGCATTCGAAGTTGACGGTCAA
>probe:Drosophila_2:1629348_at:339:209; Interrogation_Position=398; Antisense; AAGCATACTTTTGGGCTTCGCAATA

Paste this into a BLAST search page for me
GACCTGCAAGGATTTACCGCCTAATTGGTTCGTTTTACAACGTGGTCAAGTTACAACGTGGTCAAGATGGGTCTTAAGATGGGTCTTGTGGCACTTGGACACTTGGACGCCTTTCGACGATCGTTTTCGACGATCGTTTCGCGGCCTAAATTTCGCGGCCTAAATCAGCACGTATAAATCAGCACGTATGCGGTGGCCAAGTATGCGGTGGCCAAGACTGTATCTAAGACTGTATCTTTTGCGCTCTAAAGAACTCTGGCTTTAAAATCATTTGGAAATCATTTGGTATCGGCATTCGAAATCGGCATTCGAAGTTGACGGTCAAAAGCATACTTTTGGGCTTCGCAATA

Full Affymetrix probeset data:

Annotations for 1629348_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720